Blood online
Home About Blood Authors Subscriptions Permission Advertising Public Access contact us
 

 
Advanced
Current Issue
First Edition
Future Articles
Archives
Submit to Blood
Search
American Society of Hematology
Meeting Abstracts
Email Alerts

Blood, Vol. 113, Issue 5, 1075-1085, January 29, 2009
This Article
Right arrow Abstract
Right arrow Full Text
Services
Right arrow Email this article to a friend
Right arrow Alert me to new issues of the journal
Right arrow reprints & permissions
Right arrow Rights and Permissions
Citing Articles
Right arrow Citing Articles via CrossRef

A retroviral mutagenesis screen reveals strong cooperation between Bcl11a overexpression and loss of the Nf1 tumor suppressor gene
Blood Yin et al. 113: 1075

Supplemental materials for: Yin et al

Files in this Data Supplement:

  • Table S1. Summary of proviral insertion sites (PIS) isolated from (XLS, 14 KB)

  • Table S2. Candidate leukemia genes identified in this MuLV screen (XLS, 24 KB) -
    The column "RTCGD CIS" indicates CISs that can be found in the Retrovirus Tagged Cancer Gene Database (http://rtcgd.abcc.ncifcrf.gov/) for the corresponding genes identified in this screen. The column "Human syngeneic pos." describes where the CIS-target genes are located in human cytogenetic positions. The column "Human chromosomal abnormality" denotes those human diseases from which the balanced chromosomal abnormailities are recurrently detected at the corresponding cytogenetic positions according to the Mitelman Database of Chromosome Aberrations in Cancer (http://cgap.nci.nih.gov/Chromosomes/RecurrentAberrations). AML: acute myeloblastic leukemia; ALL: acute lymphoblastic leukemia; CML: chronic myeloid leukemia; CLL: chronic lymphoblastic leukemia.

  • Table S3. Known genes identified as single insertion site in this screen (XLS, 14 KB)

  • Table S4. Analysis of peripheral blood cells of recipient mice (XLS, 15 KB) -
    Blood cells were collected 3 weeks after administration of pI-pC or when animal became moribund (*). Minute white nodules were seen on some kidneys of moribund recipient mice. The numbers in parenthases indicate values of standard derivation. WBC: white blood cells; RBC: red blood cells.

  • Figure S1. The schematic representation of the CIS targeting Ahi-1/c-myb (JPG, 35.6 KB) -
    The red arrows indicate the relative position and orientation of cloned proviral insertions, and the black arrow heads the transcriptional start sites and orientation of individual gene. The brown boxes denote exons of Ahi-1; the blue ones those of c-myb. The light blue arrows indicate previously reported proviral insertion regions isolated from murine leukemias other than BXH-2 AML.





  • Figure S2. The schematic representation of the CIS targeting Spred2 (JPG, 31.8 KB) -
    The red arrows indicate the relative position and orientation of cloned proviral insertions. The blue boxes indicate exons of Spred2.





  • Figure S3. Examination of bone marrow engraftment and Bcl11a delivery in recipient mice by PCR on peripheral blood cells (JPG, 62.5 KB) -
    NC: no DNA as a negative control for PCR. (A) Detection of the floxed allele of Nf1 and its recombined allele. The size of PCR products for wild-type (Wt), floxed (Flox) and recombined (Del) allele of Nf1 are 480 bp, 350 bp and 280 bp, repectively. Peripheral blood cells were derived from mice receiving Nf1(+∕+).Cre bone marrow transduced with vector (#1) or Bcl11a-expressing retrovirus (#3), or receiving Nf1(Flox∕Fcr).Cre cells transduced with vector (#2) or Bcl11a-expressing retrovirus (#4). PC1: positive control for wild-type Nf1 allele. PC2: positive control for wild-type and floxed Nf1 allele. (B) Detection of the knockout allele of Nf1. The size of PCR products for wild-type (Wt) and knockout (Fcr) are 350 bp and 200 bp, repectively. Lanes #1, #2, #3, #4 and NC are results for peripheral blood cells annotated as above in (A). (C) Detection of the Bcl11a-expressing retroviral construct. The size of PCR product is 254 bp. Shown here are PCR results for Nf1(+∕+).Cre (lanes 1~3) and Nf1(Flox∕Fcr).Cre (lanes 4~6) bone marrow cells transduced with Bcl11a-expressing retrovirus.





  • Figure S4. Southern blotting assay reveals the presence of transgene in Bcl11a-transduced leukemia (JPG, 51 KB) -
    (A) The schematic representation of the Bcl11a-expressing retroviral construct used for transduction of bone marrow cells. (B) The genomic DNA extracted from tumors harvested from the enlarged lymph nodes and thymi of recipient mice were double digested with Bgl II and Sal I, followed by hybridization with the construct-specific probe as indicated above in (A) as a pink bar. The arrow head indicates the bands with the expected size.





  • Figure S5. Detection of genomic rearrangements at the Evi9 locus by Southern blotting assay (JPG, 116 KB) -
    The numbers indicate relative distance in base-pair. Hatched box: proviral insertions at Evi9 identified in this study. Black bar: the probe prepared by PCR using the primers (5′ CAGACCTGGATTCAGACTCAAAC 3′ and 5′ GTGTATGTATGTGTGAGGAGGCA 3′), and was used for screening genomic alterations. (A). Pvu II-restriction map of Evi9 locus. (B). Pvu II-restriction map of BXH-2 retrovirus. (C) and (D). Results of Southern blotting for examining proviral insertions at the Evi9 locus in 40 additional Nf1-wild type leukemias. Genomic DNA was digested with Pvu II and hybridized with the PCR-generated probe which allowed detection of the 6864-bp wild-type band, as indicated by arrow heads, and rearranged DNA, if any, ranging from 4350-bp to 11090-bp. The 8.5-kb band could come from another allele at this locus, or likely, non-specific signals as lower stringent hybridization conditions were used in this experiment with the aim to detect potential weak rearrangement signals. As can be seen here, our results did not show any DNA rearrangements.





This Article
Right arrow Abstract
Right arrow Full Text
Services
Right arrow Email this article to a friend
Right arrow Alert me to new issues of the journal
Right arrow reprints & permissions
Right arrow Rights and Permissions
Citing Articles
Right arrow Citing Articles via CrossRef

 click for free articles
home about blood authors subscriptions permissions advertising public access contact us
  Copyright © 2009 by American Society of Hematology         Online ISSN: 1528-0020