Blood online
Home About Blood Authors Subscriptions Permission Advertising Public Access contact us
 

 
Advanced
Current Issue
First Edition
Future Articles
Archives
Submit to Blood
Search
American Society of Hematology
Meeting Abstracts
Email Alerts

Blood, Vol. 113, Issue 5, 1184-1191, January 29, 2009
This Article
Right arrow Abstract
Right arrow Full Text
Services
Right arrow Email this article to a friend
Right arrow Alert me to new issues of the journal
Right arrow reprints & permissions
Right arrow Rights and Permissions
Citing Articles
Right arrow Citing Articles via CrossRef

Dusp-5 and Snrk-1 coordinately function during vascular development and disease
Blood Pramanik et al. 113: 1184

Supplemental materials for: Pramanik et al

Files in this Data Supplement:

  • Document 1. Supplemental materials and methods (PDF, 21.2 KB)

  • Figure S1 (JPG, 282 KB) -
    (A) Alignment of amino acid sequences of human (NP_004410), mouse (NP_001078859), and zebrafish Dusp-5 (NP_997730) in which the shaded regions show conserved residues. Region between: black arrows indicate Rhodanese-like domain (7-135AA), green arrows indicate Protein-tyrosine phosphatase domain (58–313 AA), purple arrows indicate dual specificity phosphatase, catalytic domain and black angle brackets represent tyrosine-specific protein phosphatase active site (261–273AA). (B) Exon-intron structure of dusp-5 and the relative positions of the morpholinos. Arrows indicate primer locations for analyzing targeting of endogenous dusp-5 transcript. Red arrows indicate primers that amplify the non-targeted region (exon 1): F, ATCAGAGGCTCCGTCAATGT; R, GCTACTCGTCAAGTGCGACA. Black arrows represent primers designed across exons to analyze targeting of the splice morpholino (MO1): F, ACTTTGTCGCACTTGACGAG; R, TGGGTTTTCATGATGTACGC. (C) RT-PCR across the targeted region with primers depicted in panel (B) and using total RNA isolated from uninjected or MO-injected embryos at 24 hpf (6 ng or 12 ng per embryo). PCR with actin primers served as an internal control. PCR with exon-flanking primers shows multiple alternate transcripts in MO1-injected embryos (black and red asterisks). Exon 1-amplifying primers in the right panel show comparable size and levels of PCR product in MO1-injected and uninjected (UI) embryos. M1: 100 bp DNA ladder; M2: 1 kb DNA ladder marker. (D) is a western blot depicting phospho-Erk (p-Erk) levels in uninjected (UI) or dusp-5 MO (MO1) injected embryos. Total Erk level is indicated for each sample.





  • Figure S2 (JPG, 33.9 KB) -
    Panels (A) and (B) shows quantification of defective embryos injected with dusp-5 MO1 and MO2 respectively. The x-axis describes the different sample groups, and the y-axis indicates the percentage of defective embryos. Etsrp+ indicates staining levels seen in uninjected embryos (Fig. 1M) while etsrp+++ indicates staining levels observed in panel (Fig. 1N or 1O), trunk region. Doses are shown below in parentheses for each MO. For panel A 6 som embryos uninjected (UI, n=107), MO1, 6 ng (n=60) or 12 ng (n=79) and 18 som embryos uninjected (UI, n= 59), MO1 12 ng (n=64). For panel B, uninjected (UI, n=13), MO2, 6 ng (n=30), and MO2, 12 ng (n=26). (C to J) represent flk+ in situs of uninjected embryos (C and D) or embryos injected with dusp-5 mRNA (E and F), snrk-1 mRNA (G and H) or both (I and J) at 14 (C–I) and 18 som (D–J). (C) At 14 som, flk+ cells display typical Y-shaped (white arrows) angioblast migration to the midline from the lateral mesoderm. (E) The flk+ migration pattern is perturbed in dusp-5 mRNA-injected embryos. (G) In snrk-1 mRNA-injected embryos, the over-all staining of flk has increased and similarly, the pattern appears disrupted although an increased number of flk+ angioblasts do migrate to the midline. In embryos double injected with snrk-1 and dusp-5 mRNA (I), the normal migration pattern (black arrows) of flk+ angioblasts appears to be restored and shows an intermediate phenotype between those of dusp-5 (E) or snrk-1 single mRNA-injected embryos (G). At 18 som (D–J), flk+ angioblasts in uninjected embryos (D) coalesce at the midline (asterisks in D–J), a process that is profoundly affected in snrk-1 mRNA-injected embryos (H) and more subtly in dusp-5 mRNA-injected embryos (F). Double mRNA-injected embryos (J) show an intermediate phenotype to that of single mRNA-injected embryos as previously noted at 14 som. (K) shows graphical representation of in vitro adhesion assay performed on 100 ng of dusp-5 siRNA and control lacZ siRNA transfected endothelial cells plated on uncoated (white bars), fibronectin (black bars) or laminin (grey bars) surface. The plotted data is an average of the absolute number of adherent cells to the respective substrates from 3 independent experiments and error bars represent SEM. Unpaired two-tailed t test shows significance at p<0.05 between sample groups.





  • Figure S3 (JPG, 460 KB) -
    (A) is a cartoon that depicts the diagnostic PCR process with an example of a mutant-specific primer sequence that will only generate a PCR amplicon when the appropriate target is available for hybridization at the 3′ end of the primer. The red nucleotide is the mutated residue. (B) is a sequence analysis of the DNA amplified from patients 9, 17, and 24 including the dusp-5 T-C substitution mutation (S147P) highlighted in yellow. (C) shows genomic PCR using S147P primers and R248Q primers from DNA isolated from 10 normal tonsil tissue samples. The normal dusp-5 PCR is also depicted to show equal loading and quality of genomic DNA from each sample. (D) represents the initial snrk-1 mutation analysis of the first patient that harbored the dusp-5 S147P mutation. Three mutations were detected when DNA from the patient sample was compared to the snrk-1 reference sequence NCBI Gene ID 54861. The C-A substitution leading to a S259Y mutation is found in all samples and may be a polymorphism. The A-G substitution leading to a D192G mutation was not processed further. The G-A substitution leading to a R248Q mutation was used for subsequent diagnostic PCR analysis. (E) shows sequence analysis of DNA amplified from patients 16, 20 and 27 including the snrk-1 G-A substitution mutation (R248Q) highlighted in yellow.





This Article
Right arrow Abstract
Right arrow Full Text
Services
Right arrow Email this article to a friend
Right arrow Alert me to new issues of the journal
Right arrow reprints & permissions
Right arrow Rights and Permissions
Citing Articles
Right arrow Citing Articles via CrossRef

 click for free articles
home about blood authors subscriptions permissions advertising public access contact us
  Copyright © 2009 by American Society of Hematology         Online ISSN: 1528-0020