Blood online
Home About Blood Authors Subscriptions Permission Advertising Public Access contact us
 

 
Advanced
Current Issue
First Edition
Future Articles
Archives
Submit to Blood
Search
American Society of Hematology
Meeting Abstracts
Email Alerts

Blood, Vol. 113, Issue 8, 1756-1758, February 19, 2009
This Article
Right arrow Abstract
Right arrow Full Text
Services
Right arrow Email this article to a friend
Right arrow Alert me to new issues of the journal
Right arrow reprints & permissions
Right arrow Rights and Permissions
Citing Articles
Right arrow Citing Articles via CrossRef

A role for MEIS1 in MLL-fusion gene leukemia
Blood Kumar et al. 113: 1756

Supplemental materials for: Kumar et al

4166 cell line
Spleen cells isolated from the mouse were cultured in methylcellulose medium (Methocult GF, M3534. Stem Cell Technologies, Vancouver, BC) supplemented with GM-CSF (10 ng/mL) for three serial cultures. Colonies in methylcellulose medium were harvested and grown in ASM liquid medium (DMEM with 10% FBS, 10 ng/mL IL-3, 10 ng/mL IL-6, 20 ng/mL SCF,10 ng/mL GM-CSF, 0.2 U/mL insulin, 10−5 M 2-mercaptoethanol, 0.01 M sodium pyruvate, 1% non-essential amino acids and 1mM oxaloacetic acid). When the cells were fully adapted to the liquid culture, cytokines were sequentially withdrawn from the medium until IL-3 was the only cytokine required for proliferation. The cells were routinely maintained in 4166 medium (IMDM containing 15% FBS and 2ng/ml IL-3).

Lentivirus
We screened five murine Meis1 shRNA clones from OpenBiosystems (Huntszlle, AL; Accession#: NM_ 010789; source ID: TRCN0000012523, TRCN0000012524, TRCN0000012525, TRCN0000012526, TRCN0000012527). For ease of description these clones were designated M23, M24, M25, M26 and M27 respectively. Using the online RNAi designer from Invitrogen (https://rnaidesigner.invitrogen.com/sirna/), we also cloned four additional shRNAs with a 19-base pair core sequence into the lentivirus expression vector pLL3.7 that carries an eGFP marker. One of these clones designated M1456 (5′AACGGATAACAGCAGTGAGCAATTCAAGAGATTGCTCACTGCTGTTATCCTTTTTTC3′) exhibited significant Meis1 silencing in 4166 cells. The human MEIS1 shRNA clones were also obtained from Open Biosystems (accession# NM_002398, source ID: TRCN0000015968, TRCN0000015969, TRCN0000015970, TRCN0000015971, TRCN0000015972).

The RNAi consortium (TRC) shRNAs were designed to include a hairpin of 21 base-pair sense and antisense stem, a 6 base-pair loop and cloned into the pLKO.1 lentivirus vector that carries a puromycin resistance marker. Lentivirus was produced by co-transfecting lentivirus expression vectors and packaging plasmids pMDG and pCMVR 8.91 into 293T cells. Briefly, 293T cells were grown in 6-well plates to 8 × 105 cells/well in DMEM medium with 10% FBS. Media were replaced on the day of transfection. One hundred microliters of Fugene 6 transfection mix (Roche, Indianapolis, IN) containing 2 ∝g plasmid DNA mix were added to the wells drop-wise and mixed well. Culture supernatants containing pseudovirus were harvested 48–72 h post-transfection. For pKLO.1 mediated shRNAs, viral titers were determined by transduction of NIH3T3 cells using diluted culture supernatants and determining number of viable cells after 4–5 days of culturing in the presence or absence of puromycin. Titers of M1456 lentivirus were determined by transducing 293T cells with diluted culture supernatants and determining percentage of eGFP positive cells by flow cytometry. To transduce target cells, lentivirus containing culture supernatants were filtered through a 0.45µ filter (Millipore Bedford, MA) and concentrated by ultracentrifugation at 25,000 rpm for 2 hours. The pellets were resuspended in serum-free IMDM. Unless specified, a multiplicity of infection (MOI) of 100 was used in subsequent experiments by spin transduction.

Gene expression analysis
For gene expression profiling experiments, 4166 cells were transduced with M26 or control virus for 48 hours in the presence of Puromycin. RNA was extracted using the RNeasy mini kit (Qiagen, Valencia, CA) and quality assessed using the 2100 Bioanalyzer (Agilent, Santa Clara, CA). Meis1 knockdown was confirmed by real time quantitative RT-PCR before proceeding to the next step. Labeling of RNA was performed using the 1 cycle labeling reagents as described (Affymetrix, Santa Clara, CA). Hybridization, washing and scanning were performed as described by the manufacturer. The gene expression data were pre-processed using robust multi-array average. The experiment was a matched design that could control for unknown variation of no biological interest and needs to be accounted for in differential gene expression detection. We first obtained the paired expression differences of the Meis1-knockdown and control-virus transduced cells. We then calculate the regularized t-statistic, which pools information across genes to define a two-sample paired t-statistic and could improve the overall detection power. To control for false positives, we calculate the false discovery rate (FDR, Benjamini and Hochberg 1995), which is defined as the expected proportion of false positives.

Files in this Data Supplement:





This Article
Right arrow Abstract
Right arrow Full Text
Services
Right arrow Email this article to a friend
Right arrow Alert me to new issues of the journal
Right arrow reprints & permissions
Right arrow Rights and Permissions
Citing Articles
Right arrow Citing Articles via CrossRef

 click for free articles
home about blood authors subscriptions permissions advertising public access contact us
  Copyright © 2009 by American Society of Hematology         Online ISSN: 1528-0020