|
|
Blood, Vol. 113, Issue 22, 5588-5598, May 28, 2009
Enolase-1 promotes plasminogen-mediated recruitment of monocytes to the acutely inflamed lung
Blood Wygrecka et al.
113: 5588
Supplemental materials for: Wygrecka et al
Cell culture
Human blood monocytes and U937 cells were maintained in RPMI 1640 (Invitrogen, Karlsruhe, Germany) containing 10% fetal calf serum (FCS; HyClone, South Logan, UT), 2 mM L-glutamine, and 1% penicillin/streptomycin (Invitrogen) and cultured in a humidified atmosphere of 5% CO2 at 37°C. Cells were either unstimulated, or were stimulated with lipopolysaccharide (LPS) from E. coli (0–10 µg/ml; Sigma-Aldrich, Taufkirchen, Germany) for 0–48 h. Apoptosis assay
For the assessment of apoptosis, U937 cells or human blood monocytes were stimulated with 5 µg/ml LPS for either 6 or 24 h. Cells incubated in presence of staurosporine (5 µg/ml) exhibited pronounced apoptosis after 3 h, and were thus employed as a positive control. Identification of apoptotic cells was performed using APC conjugated annexin V (Invitrogen) at room temperature for 15 min in annexin buffer (140 mM NaCl, 5 mM CaCl2, 10 mM Hepes). Cells were washed twice and then resuspended in annexin buffer. Necrotic cells were excluded by counter-staining with 2 µg/ml propidium iodide (Sigma-Aldrich). Isolation of RNA and real-time RT-PCR
Total RNA was extracted using an RNeasy Plant Mini Kit (Qiagen, Hilden, Germany). One µg of RNA was reverse-transcribed as recently described.1 The mRNA expression was analyzed by real-time PCR using the 2−ΔΔCT method for the calculation of fold-change.2 Real time PCR was performed by a Sequence Detection System 7700 (PE Applied Biosystems, Foster City, CA). Reactions were set up with Platinum SYBR Green qPCR Super Mix-UDG (Invitrogen) using 2 µl of cDNA. Oligonucleotide primers were: human ENO-1, 5′ GAATAAAGAAGGCCTGGAGC -3′ and 5′ TAGACACCACTGGGTAGTCC-3′; and human β actin: 5′-ATTGCCGACAGGATGCAGGAA-3′ and 5′ GCTGATCCACATCTGCTGGAA 3′. The β-actin gene was used as a reference gene. Cycling conditions were 95°C for 6 min, followed by 45 cycles of 95°C for 20 s, 55°C for 30 s, and 73°C for 30 s. Melting curve analysis and gel electrophoresis were performed to confirm the exclusive amplification of the expected PCR product. Stable transfection of U937 cells
The U937 cells were harvested by centrifugation from cultures in exponential growth phase, washed with PBS, and resuspended at 106 cells/ml in RPMI medium on ice. Plasmids containing wild-type ENO-1 (ENO-1WT) or ENO-1 lacking the PLG binding site (ENO 1ΔPLG) as well as empty control vectors (10 µg each) were added to cell suspension (400 µl) and maintained for 5 min on ice. Cells and DNA were then subjected to a pulse of 150 V at a capacitance of 250 µF using a Gene Pulser (Bio-Rad, Hercules, CA). Cells were returned to ice for 5 min and incubated in non-selective medium overnight. Cells were plated into a 96-well culture plate in RPMI medium containing 0.8 mg/ml G-418 Sulfate (Merck, Darmstadt, Germany). After two to three weeks, surviving clones were amplified. ENO-1 wild-type and an ENO-1 variant in which the PLG binding-site was removed (lacking the 30 C-terminal amino acids of ENO-1) were amplified from human lung cDNA by PCR using the following primers; ENO-1: forward, 5′-CCGGAATTCTATGTCTATTCTCAAGATCCATGC-3′; ENO-1WT: reverse, 5′-CGCGGATCCTTACTTGGCCAAGGGGTTTC-3′; ENO-1ΔPLG: reverse, 5′-CGCGGATCCTTACAAGCGCTCAGATCGG-3′. The PCR fragments were cloned into pcDNA3.1(+) using EcoRI and BamHI restriction sites (in bold). Cloning was confirmed by sequencing. Western blotting
Cell lysates were separated on 10% SDS polyacrylamide gels under reducing conditions followed by electrotransfer to PVDF membranes (Amersham Bioscience, Freiburg, Germany). After blocking, the membranes were probed with one of the following antibodies: rabbit polyclonal anti–ENO-1 (Santa Cruz Biotechnology, Santa Cruz, CA), anti-PLG, anti-CD18, anti-proteasome 20Sα6 (P20S; all from Abcam, Cambridge, MA), and anti–β-actin (Sigma). Membranes were incubated with peroxidase-labeled secondary antibodies (all from Dako; Glostrup, Denmark), and detection of proteins was performed using an ECL Plus Kit (Amersham Bioscience). Isolation of membrane proteins
Cells were labeled using 1 mg/ml EZ-link NHS-SS-biotin (Pierce, Rockford, IL) for 1 h at 4°C. Cells were rinsed 3× with PBS containing 100 mM glycine and lysed in cell-lysis buffer (50 mM Tris, pH 7.4, 100 mM NaCl, 50 mM NaF, 5 mM β-glycerophosphate, 2 mM EDTA, 2 mM EGTA, 1 mM sodium orthovanadate, 0.1% Triton X-100, and 25× protease inhibitor cocktail (Roche, Mannheim Germany)). Aliquots (100 µg of protein) were incubated overnight at 4°C with end-over-end shaking in the presence of streptavidin beads (Pierce). Beads were washed and resuspended in 40 µl of Laemmli sample buffer. Proteins were analyzed by western blot as described above. Immunohistochemistry and immunocytochemistry
Immunohistochemistry for the detection of ENO-1 or PLG in formalin-fixed paraffin-embedded human lung tissue was performed using Histostain-SP Kit (Zymed Laboratories Inc., San Francisco, CA). Sections were incubated with a rabbit polyclonal anti–ENO-1 antibody (1:2000; Santa Cruz Biotechnology) or an anti-PLG antibody (1:2000, Abcam) overnight at 4°C. Slides were scanned with a Mirax Desk Digital Slide Scanner (Zeiss, Göttingen, Germany) at room temperature and analyzed using a Mirax Viewer (Zeiss). For immunocytochemical analysis, U937 cells and human blood monocytes were fixed with 4% paraformaldehyde for 10 min, blocked with 3% BSA-PBS for 1 h at 4°C, and incubated with a rabbit polyclonal anti–ENO-1 antibody (1:400; Santa Cruz Biotechnology) or an anti-PLG antibody (1:200, Abcam) overnight at 4°C. Slides were incubated with FITC or rhodamine conjugated secondary antibody (Dianova, Hamburg, Germany), and mounted with Vectashield mounting medium (Vector, Burlingame, CA). Nuclei were visualized by 4′,6-diamidino-2-phenylindole (DAPI; Sigma) staining. Controls were performed by substituting the primary antibody by a non-specific antibody. Images were captured by a Leica DMR microscope (Leica, Heidelberg, Germany) with 63×/1.32–0.6 oil-objective at room temperature and photographed using MetaMorph 7.0 (Molecular Devices, Downingtown, PA). The images were processed with Adobe Photoshop 9.0 (Adobe Systems, San Jose, CA). All images illustrated are representative of at least six other areas per section, seen on at least three independent sections. Flow cytometry
Data were collected using a FACSCanto flow cytometer (BD Biosciences) and analyzed by FACSDiva (BD Biosciences) and the WinMDI 2.8 software packages (Scripps Institute, La Jolla, CA). Gates based on forward and side scatter were set to eliminate cellular debris and cell clusters. A minimum of 30,000 cells were analyzed per sample. Cells which stained positive were gated using control samples incubated in the presence of appropriate isotype controls. The U937 cells were fixed with 1% paraformaldehyde for 10 min on ice. Subsequently, the cells were washed, blocked with 3% BSA in PBS for 1 h on ice, and incubated with a rabbit polyclonal anti–ENO 1 antibody (Santa Cruz Biotechnology) or isotype control (BD Bioscience) overnight at 4°C. Cells were then washed and incubated with a FITC-labeled secondary antibody (Dianova) for 30 min at room temperature. After additional washing steps, ENO-1 presence at the cell membrane was analyzed in the FITC channel of the flow cytometer. Peripheral blood monocytes were identified from whole blood following erytholysis by staining against CD45 and CD14 using anti–CD45-APC-Cy7 and anti–CD14-PE antibodies (BD Bioscience), respectively. REFERENCES: 1. Wygrecka M, Markart P, Ruppert C, et al. Compartment- and cell-specific expression of coagulation and fibrinolysis factors in the murine lung undergoing inhalational versus intravenous endotoxin application. Thromb Haemost. 2004;92:529–540.
2. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2 (−Delta Delta C(T)) Method. Methods. 2001;25:402–408.
Files in this Data Supplement:
- Figure S1. LPS does not induce apoptosis of U937 cells and human blood monocytes after 6 h stimulation (JPG, 26.2 KB)
-
The effect of LPS treatment (5 µg/ml LPS for 6 or 24 h) on (A) U937 cell and (B) human blood monocyte apoptosis was measured by annexin V staining. Staurosporine-induced apoptosis was used as a positive control. Values represent the mean ± SD from four independent experiments; NS, not significant; * p < 0.05; ** p < 0.01.
- Figure S2. LPS-induced ENO1 cell surface expression on U937 cells promotes the directed migration of these cells through polycarbonate membranes (JPG, 161 KB)
-
Unstimulated U937 cells as well as cells exposed to 5 µg/ml LPS (6 h) were preincubated with 15 µM Lys-PLG in the absence (−) or presence of anti–ENO-1 antibodies (10 µg/ml) or IgG control (10 µg/ml). Subsequently, 3 nM t-PA was added and the cells were seeded onto a porous (5 µm) polycarbonate membrane. The inserts were placed into wells with MCP-1 and incubated for 12 h at 37°C. The cells attached to the upper part of the membrane were stained with crystal violet. All images illustrated are representative of at least three other areas per membrane, seen on at least four independent membranes. Original magnification 10×. Bar size 40 µm.
- Figure S3. LPS in the absence of plasmin does not induce migration of U937 cells and human blood monocytes through the polycarbonate membrane (JPG, 19.7 KB)
-
(A) U937 cells or (B) human blood monocytes exposed to 5 µg/ml LPS for 6 h as well as unstimulated cells were seeded onto a porous (5 µm) polycarbonate membrane. The inserts were placed into wells without (open columns) or with MCP-1 (black columns) and incubated for 12 h at 37°C. The cells present in the lower chamber were counted. Data represent mean values ± SD from four independent experiments, each performed in quintuplicate. NS; not significant.
- Figure S4. Overexpression of ENO-1WT by U937 cells increases their migratory properties through polycarbonate membranes (JPG, 101 KB)
-
Stably-transfected U937 cells as indicated were seeded onto a porous (5 µm) polycarbonate membrane. The inserts were placed into wells with MCP-1 and incubated for 12 h at 37°C. The cells attached to the upper part of the membrane were stained with crystal violet. All images illustrated are representative of at least three other areas per membrane, seen on at least four independent membranes. Original magnification 10×. Bar size 40 µm.
- Figure S5. ENO -1WT overexpression does not facilitate recruitment of monocytic cells to the spleen of mice after intratracheal LPS treatment (JPG, 90.6 KB)
-
Representative spleen tissue sections from saline- (left panel) or LPS- (right panel) treated mice injected with untransfected cells (−), mock-transfected cells (pcDNA3.1), cells overexpressing ENO-1 wild-type (ENO-1WT), or cells overexpressing ENO-1 lacking the plasminogen binding site (ENO-1ΔPLG). Original magnification 20×. Bar size 20 µm.
|
|
