|
|
Blood, Vol. 113, Issue 23, 5891-5895, June 4, 2009
Naturally occurring short splice variant of CYLD positively regulates dendritic cell function
Blood Srokowski et al.
113: 5891
Supplemental materials for: Srokowski et al
Files in this Data Supplement:
- Figure S1 (JPG, 388 KB)
-
(A) Differentiated day 6 WT BMDCs were exposed to 100ng/mL LPS at indicated timepoints or left untreated after which qRT-PCR was performed to detect mRNA levels of sCYLD or flCYLD using the following primers: sCYLD forward: CTATTGGCAACTGGGATGGAAGG, sCYLD reverse: CACTTAAATAGCCCCCAAATGCTTC and FL-CYLD forward: AGTCCACCCTTGCCCATCTCTT FL-CYLD reverse: CATTCATCTTCCAGTTCCAGTCCA. The mRNA levels were normalized by HPRT levels (forward: TTAAGCAGTACAGCCCCAAAATG, reverse: CAAACTTGTCTGGAACAAATCC) and expressed as fold change relative to unstimulated WT cells. (B) BMDCs from C57BL/6 (WT), CYLDko, CYLDex7/8 and WT/CYLDex7/8 mice were differentiated with GM-CSF for 6 days in culture and stimulated overnight with 100ng/ml LPS, 1ug/ml P3Cys or 100nM CpG and submitted to FACS analysis of the CD11c+ population for the cell surface expression of CD86. Mean fluorescence intensity (MFI) values of CD86 cell surface expression markers are representative of 3 BMDCs preparations with standard error mean (SEM) shown as error bars. (C) Immunohistochemical staining of GM-CSF–differentiated BMDCs for Bcl-3 (red), tubulin (green) and DAPI (blue) analyzed by confocal microscopy (Zeiss). Bar represents 10µM. (D) Western blot of cytoplasmic extracts from unstimulated or overnight LPS-stimulated BMDCs using anti-p105 antibody (Cell Signaling) and anti–β-actin (Sigma) for loading control. Numbers indicate relative intensity/mm2 measured on ChemiDoc XRS(Bio-Rad) between samples. Vertical lines have been inserted to indicate repositioned gel lanes. (E) Differentiated day 6 WT BMDCs were transfected with 2.5 ug Bcl-3 FLAG plasmid (Ramin Massoumi) together with 2.5 ug GFP vector using the Mouse Dendritic Cell Nucleofector Kit™ (VPA-1011; Amaxa) and stimulated overnight with 100ng/ml LPS. GFP +ve cells were gated for CD11c+ expression and CD86 expression was measured. Left: histogram overlay between GFP+ve CD11c+ cell population mock transfected vs. transfected with Bcl-3 FLAG. Right: Duplicate samples illustrating mock transfected vs. Bcl-3 FLAG transfected BMDCs and their respective CD86 high expressing population shown in histogram by indicated numbers. (F) CYLDko mouse embryonic fibroblasts (MEFs) were transfected with 2.5ug sCYLD-myc plasmid, 2.5 ug Bcl-3 FLAG (Ramin Massoumi) using the MEF 2 Nucleofector Kit (Amaxa;VPD-1005) as indicated in the figure. Immunohistochemical staining of MEFs for Bcl-3 FLAG using anti–FLAG-Cy3 (red) (Sigma) and for sCYLD-myc using anti–Myc-FITC (green) (Sigma) and DAPI (blue) according to manufacturer’s instructions and analyzed by confocal microscopy (Zeiss). Bar represents 10uM.
|
|
