|
|
Blood, Vol. 113, Issue 19, 4566-4574, May 7, 2009

A critical role of TAK1 in B-cell receptor–mediated nuclear factor B activation
Blood Schuman et al.
113: 4566
Supplemental materials for: Schuman et al
Detection of TAK1 deletion by semi-quantitative PCR BM pro/pre- (B220+IgM−), immature (B220+IgM+) and mature (B220hiIgM+) B cells, and splenic T1 (IgM+IgDlo), T2 (IgM+IgD+) and follicular mature (IgMloIgD+) B cells were sorted. Genomic DNA was isolated from the cells and was quantified by semi-quantitative PCR amplification of the β-actin gene (ACTCCTATGTGGGTGACGAG and CAGGTCCAGACGCAGGATGG C). The genomic DNA then was subjected to semi-quantitative PCR analysis of Tak1 deletion using the following primer pairs: GCACAGAAAATGCACAGTGCTC and GC TTGGGACAGGCTGGTAAAG (for the wild-type allele), GCACAGAAAATGCACAGTGCTC and CTTACAAGCCGAATTCC AGCA (for the floxed allele), and GCACAGAAAATGCACAGTGCTC and CTCCTCC ACTCCGCCCCTAC (for the deleted allele) as described.42 The PCR was carried out in a 25 µl final volume containing 0.25 µl of dNTP (10 mM), 0.5 µl of the primers (10 µM), 2.5 µl of 10 × PCR buffer, 5 µl 5 × Q-solution, 2.5 units of Taq enzyme (QIAGEN), and a 5-fold serial dilution of template. Cycling conditions were 94°C for 5 min followed by 35 cycles of 94°C for 30 s, 58°C for 30 s, and 72°C for 60 s, and a final extension step at 72°C for 10 min.
Files in this Data Supplement:
- Figure S1. Targeted disruption of the Tak1 gene in mouse B cells (JPG, 47.1 KB)
-
(A) Semi-quantitative PCR analysis of Tak1 gene deletion in B cells at different developmental stages. BM cells and splenocytes were isolated from CD19CreTak1fl∕fl mice. BM pro/pre-(B220+IgM−), immature (B220+IgM+) (IM) and mature (B220hiIgM+) (M) B cells and splenic T1 (IgM+IgDlo), T2 (IgM+IgD+) and FO mature (IgMloIgD+) B cells were sorted. Splenocytes from CD19CreTak1+∕+, Tak1fl∕fl and CD19CreTak1fl∕fl mice were used as controls. Genomic DNA was isolated from the cells and was quantified by semi-quantitative PCR amplification of the b-actin gene. The genomic DNA was then subjected to semi-quantitative PCR analysis of Tak1 gene deletion.

- Figure S2. Reduction of FO B cells in the spleens of TAK1-deficient mice (JPG, 59.8 KB)
-
Splenocytes from CD19CreTak1+∕+ and CD19CreTak1fl∕fl mice were stained with antibodies to IgM, CD21, and CD23. In CD23+-gated cells, T2 B cells (CD21hiIgMhi) and FO B cells (CD21intIgMlo) are shown. Splenocytes from PLCγ2-deficient mice (PLCγ2−∕−) were used as a gating control.

|
|