|
|
Blood, Vol. 113, Issue 23, 5747-5756, June 4, 2009
Amelioration of murine β-thalassemia through drug selection of hematopoietic stem cells transduced with a lentiviral vector encoding both  -globin and the MGMT drug-resistance gene
Blood Zhao et al.
113: 5747
Supplemental materials for: Zhao et al
Supplementary materials and methods Plasmid constructions
V5-Mp-MGMT was derived from a previously described dual gene vector by removing the γ-retroviral intronic and residual gag sequences 3′ of the MSCV LTR and eliminating the woodchuck hepatitis virus post-transcriptional regulatory element (wPRE). We found that the titer of vector was significantly diminished by inclusion of the wPRE in this particular construct, thus it was removed in order to obtain a vector with a clinically relevant titer. To construct the V5-EF1-MGMT vector, an EF1-MGMT-wPRE cassette was derived from CL20cEF1 P140KMGMT-wPRE. This fragment was inserted into V5 in the opposite transcriptional orientation to the globin cassette. Preparation of virus
In brief, 293T cells were transfected with a mixture of plasmid DNA consisting of 6 µg pCAGkGP1R (Gag/Pol), 2 µg pCAG4-RTR2 (Rev/Tat), 2 µg pCAG-VSVG (VSV-G envelope), and 10 µg of gene transfer vector plasmid per 10cm dish using the calcium phosphate precipitation technique. Twenty-four hours following transfection, cells were washed with PBS and replaced with 10 ml of serum-free X-VIVO 10 medium (Bio Whittakersville, MD) and incubated for additional 24 hours. The supernatant containing virus was harvested, cleared using low-speed centrifugation, and filtered through a 0.2 µm cellulose acetate filter. This material was concentrated by ultracentrifugation for 90 minutes at 25,000 rpm at 4°C (Beckman SW28 rotor). Viral vector was aliquoted, snap frozen on dry ice, and kept at −80°C until use. Titers of globin vector preparations were determined by genome transfer to HeLa cells, relative to that of a GFP lentiviral vector of known titer. Transduction of β-thalassemic BM cells
BM cells obtained from 3-to-5-month-old β-thalassemic mice were subjected to lineage depletion by immunomagnetic separation using the Lineage Cell Depletion Kit (Miltenyi Biotec Inc., Auburn, CA). After magnetic separation, all lineage negative cells were pooled together and resuspended in Stem Span medium (Stem Cell Technologies, Vancouver, BC, Canada) supplemented with cytokines, 10ng/ml SCF (mouse), 20ng/ml TPO (mouse), 20ng/ml IGF-2 (mouse) (all from Peprotech), 10ng/ml FGF (human) (R&D Systems Inc., Minneapolis) and 10ug/ml Heparin (Sigma-Aldrich) at a concentration of 1 × 106 cells/ml and incubated at 37°C containing with 5% CO2 for 30hrs. Following prestimulation, cells were harvested, again resuspended in Stem Span medium supplemented with the same growth factors as mentioned above, plus additional 6µg /ml polybrene (Sigma-Aldrich, St. Louis, MO) and virus was added to obtain an MOI 10. The cells were transferred into 6 well dishes coated with Retronectin (Takara, Shiga, Japan) according to the manufacturer’s recommendations. After 12 hrs, the cells were again lifted, resuspended in fresh viral vector containing medium (MOI 12) and incubated for additional 6 hrs. Cells were then harvested from the transduction culture and washed in PBS containing 2% FBS, and resuspended in the same buffer. One million transduced BM cells were injected by tail vein into female C57Bl/6J mice (Jackson Laboratories, Bar Harbor, ME) irradiated with 1125cGy. In the case in which cells were pre-treated prior to transplantation, the transduction process was as above and then cells were cultured for an additional 36 hrs in the same media and cytokines to allow expression of MGMT. Transduced cells were then treated with BG at 20 µM for 1 hr and then with BCNU at 40 µM for 2 hrs before transplantation into lethally irradiated recipients. In all cases, complete engraftment of vector-transduced or mock-transduced β-thalassemic cells was noted by the absence of wild-type C57/Bl6 hemoglobin as judged by cellulose acetate electrophoresis or HPLC. DNA analysis
BM DNA samples were digested with Bgl II, which cuts at the ends of the provirus and liberates a near unit length provirus (Fig. S1A). A radiolabeled HIV-1 RRE element DNA probe was hybridized with the blot and the signal intensity of the hybridizing band for each DNA sample was compared to that of the DNA from a K562 clone harboring a single vector copy using a Molecular Dynamic Storm 860 Phosphorimager (Sunnyvale, CA) and its accompanying software. Equivalent loading of lanes was confirmed by ethidium bromide staining of gels prior to DNA transfer to the nylon filters. BM DNAs from the primary transplanted mice and CFU-S DNA were also digested with EcoRI and XbaI, each of which cut once within the provirus. This allows identification of unique host genome-vector genome junction fragments. Identification of vector insertion sites using LAM-PCR
100 ng of BM of CFU-S DNA from the cells of treated and non-treated mice was used as a template for 2 rounds of 50-cycle reactions. The biotinylated vector-specific primer AGGGTCTGAGGGATCTCTAGTTAC was used for the first step of linear amplification. Selection of biotinylated extension products carried out using Streptavidin magnetic beads ( Dynabeads® M-270, Invitrogen Dynal As, Oslo, Norway). Extension products were incubated with Klenow DNA polymerase (2 U), dNTP and random hexanucleotide (Roche Diagnostics Corp) in a volume of 20ul for 1hr at 37°C. Samples were then washed and subsequently incubated with ApoI endonuclease for 1 hr at 37C. An asymmetric linker oligonucleotide was ligated to the digested DNA, followed by PCR amplification using 25 pmol of a vector specific oligo (CAGTGGGTTCCCTAGTTAGC) and linker cassette primer (ACTGACAGCGGAGATAATCG) for 35 cycles. A second nested PCR using 0.1 µl of product was then performed using a second set of unique primers: a LTR primer (GGCAAAAAGCAGATCTTGTCTTCTT) and linker primer (GTGCGAGTAGCATACTAGAG). Ten percent of the PCR products from this reaction was examined on a Spreadex high resolution gel (Elechrom Scientific, AG, Switzerland). The rest of the products were cleaned up using Wizard® SV Gel and PCR Clean-Up Kit (Promega Corporation, Madison) and cloned into the TOPO TA vector (Invitrogen, Carlsbad, CA). Individual bacterial clones were identified, plasmid DNA prepared, and DNA sequenced by the Hartwell Center for Biotechnology and Bioinformatics (St. Jude Children’s Research Hospital, Memphis, TN). Sequences were analyzed using the UCSC Blast-like alignment tool (BLAT) genome browser.
Files in this Data Supplement:
- Table S1. V5-EF1a-MGMT vector insertions in treated and untreated mice (XLS, 32 KB)
- Figure S1. Schematic representations of γ-globin/MGMT dual gene lentiviral vectors and in vivo selection experimental design (JPG, 77.4 KB)
-
(A) The integrated γ-globin/MGMT lentiviral vector proviral forms are shown. Both vectors contain the same composite 3.1 kb of transcriptional regulatory sequences from the β-globin LCR with contributions, as indicated, from HS4 (1254 bp), HS3 (851 bp), and HS2 (1097 bp), coupled with a 130 bp β-globin promoter and genomic γ-globin sequences. The vector backbones contain the central polypurine track (CPPT) and the rev responsive element (RRE), as indicated, and have a SIN design in which the promoter and enhancer of the HIV U3 region are deleted. The Mp enhancer/promoter and the EF1α cellular promoter with intron are used to drive MGMT expression in the two vectors, as indicated. The woodchuck hepatitis virus post-transcriptional regulatory element (wPRE) is present in the EF1α vector, while absent in the Mp vector due to its negative effect on vector titer. (B) Experimental design of in vivo selection experiments.
- Figure S2. Generation of high titered γ-globin/MGMT lentiviral vectors (JPG, 42.5 KB)
-
Southern blot analysis of genomic DNA from 293T cells transduced with the indicated amounts of a control GFP lentiviral vector and the γ-globin/MGMT lentiviral vectors as indicated. M= DNA size standards as indicated. 293T= untransduced, negative control cells. Gels for the two different vectors are labeled and a band of the predicted molecular size, as indicated by the arrow was observed. The titer of the GFP control lentiviral vector was 2 × 107 transducing units per ml. Conc = concentrated by ultracentrifugation 550–625-fold; Unconc = unconcentrated vector.
- Figure S3. Significant increases in F cells following in vivo selection (JPG, 56.6 KB)
-
FACS histograms from representative animals transplanted with V5-EF1-MGMT transduced β-thalassemic BM cells before (left panels) and after (right panels) BG/BCNU administration. Histograms from treated and control, untreated animals are separated by the dotted line.
- Figure S4. Quantitation of HbF using HPLC (JPG, 35.1 KB)
-
HPLC analysis of red cell lysates from mice that received cells transduced with the γ-globin/EF-1MGMT and received no drug administration (mouse #20) or 3 courses of BG/BCNU (mouse #1). The HbF peak comes off the column at a retention time of 0.862 seconds, as indicated.
- Figure S5. Oligoclonal hematopoiesis predominates in both drug-treated and control, untreated animals transplanted with V5-EF1-MGMT transduced β-thalassemic BM cells (JPG, 81 KB)
-
(A) Southern blot analysis of genomic DNA, cut with EcoRI, from the BM of individual, drug-treated mice (indicated by mouse #) and 2° CFU-S derived from that BM, as indicated. + = DNA from a single copy control cell line. Fractions at the bottom left and right of each gel represents the number of vector DNA positive CFU-S over the total number evaluated. The vertical lines in the lower right blot indicate that the inserted panel was derived from a different blot which was run in parallel. (B) Southern blot analysis, as above, of CFU-S derived from two control, untreated mice. 5 of 22 total colonies in these two animals were positive for vector DNA. None of 11 colonies from a third animal were positive for vector DNA.
|
|
