|
|
Blood, Vol. 113, Issue 22, 5423-5433, May 28, 2009
Toward a stem cell gene therapy for breast cancer
Blood Li et al.
113: 5423
Supplemental materials for: Li et al
Lentivirus vectors: The cDNA for mouse Rlx-1 was generously provided by Dr. Bathgate (University of Melbourne, Australia).1 The coding region was amplified by PCR using the following primers: 5′ ACGACCGGTGCAACACCCAGACCTCCA and 5′GCGTCTGCAGTAGTGGGACCTGACAGAAGC. The PCR product was cloned as an AgeI/PstI fragment into pTREAutoR3 instead of the GFP gene. pTREAutoR3 was provided by Dr. J Seppen (University of Amsterdam, The Netherlands).2 It contains a minimal CMV promoter linked to seven copies of a tet-operator, the HBV PRE, and a bicistronic cassette composed of the transgene and the tetracycline responsive transactivator under the control of CMV promoter. The vectors expressing bGal or GFP under the control of the CMV promoter have been described previously.3,4 VSVG-pseudotyped vector stocks were prepared and titered as described elsewhere.5 Mouse Y-chromosome FISH: We used the “STARFISH Conc mouse Cy3Chr Y Paint” kit (1200-YMCY3-02) from Cambio Ltd (Cambridge, UK). Briefly, 8 µm thick frozen sections were fixed in methanol/acidic acid (vol/vol 3:1) for 20 min at room temperature. After dehydration with 70%, 90%, and 100% ethanol, sections were subsequently treated with 0.3% Triton-X100 for 5 min. Sections and probe were heat-denatured and 10 µl of the probe per 18 mm2 was added to the slide and incubated overnight at 37°C in hybridization buffer provided by the manufacturer. The next day, sections were subsequently washed with formamide/2xSSC (vol/vol 1:1) and 2xSSC at 45°C in water bath. Sections were then air-dried and covered with Vectashield containing DAPI (Vector Labs, Burlingame, CA). Cells: MMC cells were cultured in RPMI 1640 medium supplemented with 20% FBS, 1mM sodium pyruvate, 10 mM HEPES, 2mM L-glutamine, 100 U penicillin/ml, and 100µg streptomycin/ml (Pen-Strep). Human CD34+ cells were isolated from umbilical cord blood (UCB) under an institutional review board-approved protocol. UCB mononuclear cells (MNCs) were isolated by density gradient centrifugation using lymphocyte separation medium (Cellgrow, Mediatech, Inc. Herndon, VA) and aliquots were stored in liquid nitrogen. The day before lentivirus transduction and cell transplantation, MNCs were recovered from liquid nitrogen, and CD34+ cells were purified by immunomagnetic isolation (Miltenyi Biotec Inc., Auburn, CA). Purified CD34+ cells were incubated overnight in Iscove modified Dulbecco medium (IMDM) supplemented with 20% FCS, 10−4 M ß-mercaptoethanol, 2 mM L-glutamine, 200 U/ml IL-3, 240 ng/ml IL-6, 200 ng/ml of stem cell factor (SCF), 26ng/ml G-CSF, and 40ng/ml FMS-like tyrosine kinase (Flt-3L) (IMDM + supplements). qRT-PCR for Rlx expression: mRNA isolation from MMC-Rlx cells and qRT-PCR was performed as described recently.6 cDNA was synthesized using the QuantiTect Reverse Transcription kit (Qiagen). For PCR the SYBR kit and the following primers were uses 5′ttcgcaataggcaaagtgaa and gtgggacctgacagaagcat. Rlx mRNA was equalized to levels of GAPDH mRNA measured in parallel in each sample. Rlx activity assay: The activity of Rlx in culture supernatants was measured based using a cAMP bioassay as described elsewhere.7 Morphometry: Images of anti-collagen IV labeled tumor paraffin sections were taken using a Leica DFC300FX digital camera with a Leica DMLB microscope. Five tumor samples of each experimental group were studied. Ten 20×-magnification pictures that covered the whole tumor section were used for each sample. The collage IV positive area (area of collagen IV/ per mm2 tumor) was measured using Image-Pro Plus software (Media Cybernetics, Bethesda, MD). To quantify tumor infiltrate cells, for each tumor section, anti-CD45 positive cells were counted in 5 random 20 × fields with an area of 1 mm2. REFERENCES 1. Bathgate RA, Lekgabe ED, McGuane JT, et al. Adenovirus-mediated delivery of relaxin reverses cardiac fibrosis. Mol Cell Endocrinol. 2007.
2. Markusic D, Oude-Elferink R, Das AT, Berkhout B, Seppen J. Comparison of single regulated lentiviral vectors with rtTA expression driven by an autoregulatory loop or a constitutive promoter. Nucleic Acids Res. 2005;33:e63.
3. Patijn GA, Terpstra OT, Kay MA. Method for continuous infusion into the portal vein of mice. Lab Anim Sci. 1998;48:379–383.
4. Neff T, Peterson LJ, Morris JC, et al. Efficient gene transfer to hematopoietic repopulating cells using concentrated RD114-pseudotype vectors produced by human packaging cells. Mol Ther. 2004;9:157–159.
5. Horn PA, Topp MS, Morris JC, Riddell SR, Kiem HP. Highly efficient gene transfer into baboon marrow repopulating cells using GALV-pseudotype oncoretroviral vectors produced by human packaging cells. Blood. 2002;100:3960–3967.
6. Stone D, Liu Y, Li ZY, et al. Biodistribution and safety profile of recombinant adeno-associated virus serotype 6 vectors following intravenous delivery. J Virol. 2008;82:7711–7715.
7. Silvertown JD, Geddes BJ, Summerlee AJ. Adenovirus-mediated expression of human prorelaxin promotes the invasive potential of canine mammary cancer cells. Endocrinology. 2003;144:3683–3691.
Files in this Data Supplement:
- Table S1. List of antibodies used for immunofluorescence analyses (PDF, 35.2 KB)
- Table S2. Expression of surface markers on tumor-infiltrating cells (TI-Leu) and bone marrow smears (PDF, 23.8 KB) -
Human CD34+ cells were transduced with a GFP-expressing lentivirus vectors and transplanted into sublethally irradiated CB17 SCID/beige mice. Six weeks later, mice received MDA-MB435 cells. Tumor-bearing liver sections and bone marrow from the study described in were stained with antibodies that were specific for the human markers. (+) means weak positive. As a positive control we used sections of human spleen and kidney.
- Figure S1. Rlx mRNA expression in MMC cells (JPG, 32.2 KB)
-
MMC cells were incubated with 1mg/ml Dox or PBS. Total RNA was isolated 24 hours later and analyzed for Rlx mRNA by qRT-PCR. Shown is fold expression Rlx RNA over GAPDH RNA levels. N=3.
- Figure S2. Larger magnification of Fig. 2B (JPG, 632 KB)
-
The size bar is 100mm. red: laminin, green: CD45, blue: nuclei.
- Figure S3. Effect of Dox on tumor growth (JPG, 107 KB)
-
Neu-tg mice or CB17 SCID/beige mice bearing MMC tumors were given Dox, starting at day 2 after tumor cell transplantation. Tumor size was measured daily. Endpoint for survival studies was the day when tumors reached a size of 200mm3 (N=7).
- Figure S4. Rlx mRNA levels in clones derived from MMC-Rlx (JPG, 557 KB)
-
A total of 42 clones were analyzed. The numbers represent Rlx mRNA levels compared to GAPDH mRNA levels. The clones marked in red were used for subsequent studies. Show are also Rlx RNA levels in the pool of transduced MMC cells (in yellow).
- Figure S5. Immune cell depletion efficiency at day 3 after a single injection of corresponding antibodies analyzed in splenocytes (JPG, 114 KB)
-
Neu-tg mice received i.p. injection of anti-CD4, (clone GK1.5), anti-CD8 (clone 169.4), and anti-GM1 (Cedarlane Inc) 3 days before transplantation of MMC-Rlx cells and then every 4th day. Control mice were injected with isotope control antibody. All mice received Dox. NK-cells were measured using NK-1.1 and anti-CD3 antibodies; NK-T cells are double positive.
- Figure S6. Effect of immune cell depletion (JPG, 63.1 KB)
-
Neu-tg mice received i.p. injection of anti-CD4, anti-CD8, and anti-GM1 three days before transplantation of MMC-Rlx cells (pool) and then every 4th day. Control mice were injected with isotope control antibody. All mice received Dox. Shown are Kaplan-Meyer survival studies. Endpoint was the day when tumors reached a size of 200mm3 (N=7).
- Figure S7. Effect of low-dose cyclophosphamide and intratumoral relaxin expression in imunodeficient mice (JPG, 126 KB)
-
MMC and MMC-Rlx cells were s.c injected into CB17 SCID-beige mice. Three days later animals received drinking water with or without Dox starting. At day 12 post tumor transplantation, mice were injected intraperitoneally with 2mg of cyclophosphamide (CY) or PBS. Mice were sacrificed three weeks later. Tumors were excised, micro-dissected and weighed. Shown is the tumor weight (N=5).
Additional supplemental figures can be seen here.
|
|
