|
|
Blood, Vol. 114, Issue 9, 1831-1841, August 27, 2009
Enrichment of Sca1+ hematopoietic progenitors in polycythemic mice inhibits leukemogenesis
Blood Usenko et al.
114: 1831
Supplemental materials for: Usenko et al
Reverse transcriptase-polymerase chain reaction (RT-PCR) and real time PCR
Total RNA was isolated from erythroleukemia cell lines H7, H9, T5, and T6 and used for cDNA synthesis using Superscript II reverse transcriptase with random hexamers. The cDNA was used for PCR in a final volume of 25 mL with 5 nM dNTP, 10 pM each of primers, 0.4U Taq DNA polymerase, and 10× reaction buffer (Invitrogen, Life Technologies, Oakville, ON, Canada), using a PTC-100 cycler (MJ Research, Watertown, MA). The PCR reaction consisted of 35 cycles of the following steps: 94°C for 30 sec, 58°C for 1 min, 72°C for 1 min. PCR primers were as follows: F-MuLV forward primer 5′-CACCATCAGAATCGACATGG, reverse primer 5′-TCCAATTGTCCATGAGGTGA; mouse HPRT forward primer 5′-CCAGCAAGCCTTGCAACCTTAACCA, reverse primer 5′-GTAATGATCAGTCAACGGGGGAC; mouse Fli-1 forward primer 5′-ACGGATTGATGGAGATTGAC, reverse primer 5′- AGGAGAGGACTTTTGTTGAGG; iNOS forward primer 5′- TGAACCCCAAGAGTTTGACC, reverse primer 5′ TGCTGAAACATTTCCTGTGC; iNOS real-time PCR forward primer 5′-AACGGAGAACGTTGGATTTG, reverse primer 5′-CAGCACAAGGGGTTTTCTTC; eNOS forward primer 5′-TCTTCGTTCAGCCATCACAG, reverse primer 5′- AGTAACAGGGGCAGCACAT; eNOS real-time PCR forward primer 5′-CTGTGGTCTGGTGCTGGTC, reverse primer 5′-TGGGCAACTTGAAGAGTGTG; GAPDH forward primer 5′- AACTTTGGCATTGTGGAAGG, reverse primer 5′-TGTGAGGGAGATGCTCAGTG. The sequences of primers used for the lineage-specific gene expression analysis were described elsewhere.50 PCR products were resolved on 2% agarose gels and images were obtained by Gel Doc 2000 digital software (Bio-Rad, Hercules, CA). The QuantiTect SYBR Green PCR kit (Qiagen) was used for real-time PCR. Roche LightCycler Version 3.5 and Lightcycler Relative Quanlification Software Verson 1.01 were used for real time PCR performance and analysis. The final results were expressed as Normalized Ratio (RTR).
Files in this Data Supplement:
|
|
