|
|
Blood, Vol. 113, Issue 22, 5605-5608, May 28, 2009
Molecular mechanisms of the defective hepcidin inhibition in TMPRSS6 mutations associated with iron-refractory iron deficiency anemia
Blood Silvestri et al.
113: 5605
Supplemental materials for: Silvestri et al
Matriptase-2 mutagenesis
Matriptase-2 cDNA was mutagenized using pcDNA3.1-MT-2WT or pcDNA3.1-MT-2ΔSP devoid of the serine protease domain as template and the QuickChange site directed mutagenesis kit, according to the manufacturers’s protocol. Oligonucleotides were as follows:
G442R-sense: 5′ CAGATCTCCCTCACCAGGCCCGGTGTGCGGGTG 3′
G442R-antisense: 5′ CACCCGCACACCGGGCCTGGTGAGGGAGATCTG 3′
D521N-sense: 5′ GATTGTCTCAACGGCAGCAATGAAGAGCAGTGCCAG 3′
D521N-antisense: 5′ CTGGCACTGCTCTTCATTGCTGCCGTTGAGACAATC 3′
E522K-sense: 5′ TCAACGGCAGCGACAAAGAGCAGTGCCAG 3′
E522K-antisense: 5′ CTGGCACTGCTCTTTGTCGCTGCCGTTGA 3′ Immunoprecipitation analysis
Immunoprecipitation of matriptase-2 and HJV was performed as described11 using different concentration of Matriptase 2. In order to avoid the variability of HJV cleavage by the serine protease of mutant proteins and since interaction occurs between MT2Mask and HJV11, for immunoprecipitation studies we generated a Matriptase-2 without the serine protease domain (ΔSP) before introducing the mutation of interest. HeLa cells were cotransfected with increasing concentrations (1, 2 or 5 µg) of MT2ΔSP (ΔSP) or mutant (ΔSPG442R, ΔSPD521N, ΔSPE522K) expressing vectors in the presence of a fixed amount (10 µg) of HJV or of an empty vector. In this way the results obtained are comparable between the studied proteins since cleavage of HJV does not occur during the experiment.
Files in this Data Supplement:
- Figure S1. Changes in hematological parameters and indices of iron status induced by iron therapy in the proband with IRIDA (JPG, 56.6 KB)
-
(A) Variations of hemoglobin concentration, mean corpuscular volume (MCV), serum ferritin, and serum iron concentrations during the course of oral iron therapy (between 1998 and 2001) The iron therapy was initiated when the patient was 1 year old. (B) The same parameters during and after a course of intravenous iron therapy (100 mg per week during 8 consecutive weeks, starting January 2004 at age 7).
- Figure S2. Pedigree of the family and segregation of TMPRSS6 mutations (JPG, 41.6 KB)
-
- Figure S3. Quantification of membrane bound matriptase-2 (m-MT2) by binding assay (JPG, 10.2 KB)
-
Hela cells were transiently transfected with the wild type and mutant expressing vectors, or with the empty vector, and analyzed for the amount of matriptase-2 on the cell surface, as described.11 The amount was calculated as the ratio between the absorbance of unpermeabilized and permeabilized cells, corrected for the absorbance of the empty vector transfected cells. Error bars indicate standard deviation. Statistical significance was calculated on a total of three experiments, made in triplicate. ns indicates no statistical significance, * p<0,05 and ** p<0,005.
- Figure S4. Coimmunoprecipitation of HJV and mutant matriptase-2 (JPG, 75 KB)
-
HeLa cells were cotransfected with increasing concentrations of MT2ΔSP (ΔSP) and mutants MT2ΔSP (ΔSPG442R, ΔSPD521N, ΔSPE522K) expressing vectors in the presence of a fixed amount of HJV or an empty vector (mock), as in the supplemental methods above. Pre-cleared whole cell extracts were immunoprecipitated with anti-HJV and revealed with anti-FLAG antibodies, which recognizes MT2. To control for transfection, whole cell extracts were loaded and revealed with anti-HJV and anti-FLAG antibodies. CL: cellular lysates.* indicates unspecific band.
|
|
