|
|
Blood, Vol. 113, Issue 17, 4049-4051, April 23, 2009
Aberrant expression of the homeobox gene CDX2 in pediatric acute lymphoblastic leukemia
Blood Riedt et al.
113: 4049
Supplemental materials for: Riedt et al
Healthy donor PB and BM samples underwent erythrocyte lysis prior to analysis. B, T and NK cells were sorted from PB using PE-conjugated antibodies (BD Pharmingen) for CD19+, CD3+ and respectively CD56+ and MACS columns (Miltenyi) (sample purity after sort > 90%). Patient MNC were obtained from BM or PB samples by density centrifugation. RNA was isolated with RNeasy Mini-Kit (Qiagen) and cDNA produced using Transcriptor First Strand cDNA Synthesis Kit (Roche). CDX2 gene transcripts were detected by real-time reverse-transcription polymerase chain reaction (RT-PCR) (qPCR) using a LightCycler® carousel-based system and LightCycler® TaqMan Master chemistry (Roche, Mannheim, Germany). Relative expression levels were calculated after normalization to the housekeeping gene PBGD. The relative level of CDX2 mRNA in a sample was expressed as the percentage ratio CDX2/PBGD. Real-time PCR assays were designed by the ProbeFinder software tool (Roche). Primer sequences were: F-CDX2 5′ atcaccatccggaggaaag 3′, R-CDX2 5′ tgcggttctgaaaccagatt 3′ in combination with Universal ProbeLibrary probe #34 (Roche), F-PBGD 5′ cgcatctggagttcaggagta 3′, R-PBGD 5′ ccaggatgatggcactga.3′and probe #18 (Roche).
The NALM-16 cell line was provided by Hans-Jörg Bühring, University of Tuebingen Medical Center II, Tuebingen, Germany. Other cell lines were purchased from ATCC or DSMZ.
Files in this Data Supplement:
- Table S1. Pediatric ALL: patient´s characteristics (PDF, 13.4 KB) -
Abbreviations: ALL, acute lymphoblastic leukemia; c-ALL, common ALL; T-ALL, T-cell ALL; pre–B-ALL, pre–B-cell ALL; BM, bone marrow; PB, peripheral blood; MRD, minimal residual disease.
- Figure S1. CDX2 expression in healthy donor cells and neoplastic lymphoid cell lines (JPG, 65.4 KB)
-
(A) CDX2 gene expression measured by LightCycler® quantitative RT-PCR shows no or very low expression in healthy donor peripheral blood (pB), bone marrow (BM), and CD19+, CD3+ and CD56+ sorted cells. (B) Various levels of CDX2 gene expression were detected in lymphoblastic and neoplastic lymphatic cell lines (CCRF-CEM; 380; Jurkat; Reh; NALM-16; MOLT-4) and the colon adenocarcinoma cell line CACO-2 used as a positive control. (C) CDX2 protein expression was detected by intracellular flow cytometry in lymphoblastic cell lines with high CDX2 gene transcript levels. Intracellular flow-cytometry was performed after membrane permeabilization and staining with anti-CDX2 antibody (Biogenex) and secondary antibody conjugated with Alexa Fluor 488 (Invitrogen). The colon adenocarcinoma cell line CACO-2 was used as a positive control. Abbreviations: PB, peripheral blood; BM, bone marrow; CCRF-CEM (T-ALL, ATCC); U-937 (histiocytic lymphoma, ATCC); Jurkat (T-ALL, ATCC); Reh (non-T–non–B-ALL, ATCC); NALM-16 (preB-ALL; a gift from Dr. Hans-Jörg Bühring, University of Tuebingen Medical Center II, Tuebingen, Germany); MOLT-4 (T-ALL, ATCC); CACO-2 (colon adenocarcinoma, DSMZ); Isotype ctrl: isotype control.
- Figure S2. Sample source in the analyzed cohort of pediatric ALL patients (JPG, 49.2 KB)
-
(A) Distribution among the four CDX2 expressor groups. c-ALL samples are collected mostly from BM, while more T-ALL samples are collected from PB. (B) Distribution among the analyzed day 33 MRD positive patients. Samples from both BM and PB are included in all represented patient groups. Abbreviations: BM, bone marrow; PB, peripheral blood; ALL, acute lymphoblastic leukemia; c-ALL, common acute lymphoblastic leukemia; T-ALL, T-cell acute lymphoblastic leukemia; B-CLL, B-cell chronic lymphocytic leukemia; AML, acute myeloid leukemia; MRD, minimal residual disease.
|
|
