Blood online
Home About Blood Authors Subscriptions Permission Advertising Public Access contact us
 

 
Advanced
Current Issue
First Edition
Future Articles
Archives
Submit to Blood
Search
American Society of Hematology
Meeting Abstracts
Email Alerts

Blood, Vol. 114, Issue 8, 1585-1595, August 20, 2009
This Article
Right arrow Abstract
Right arrow Full Text
Services
Right arrow Email this article to a friend
Right arrow Alert me to new issues of the journal
Right arrow reprints & permissions
Right arrow Rights and Permissions
Citing Articles
Right arrow Citing Articles via CrossRef

The proteomic signature of NPM/ALK reveals deregulation of multiple cellular pathways
Blood Lim et al. 114: 1585

Supplemental materials for: Lim et al

Cell lines
Jurkat cells (ATCC TIB 152) were derived from acute T-lymphoblastic leukemia. The SUDHL-1 (DSMZ ACC 356) and Karpas 299 (DSMZ ACC 31) cell lines were derived from ALCLs, and both cell lines carry a t(2;5)(p23;q35) aberration producing the NPM/ALK fusion gene. The Mac2A cell line was derived from a case of peripheral T-cell lymphoma and does not harbor the t(2;5)(p23;q35). Cells were maintained in RPMI 1640 medium (Novatech Inc., Grand Island, NE, USA) supplemented with 1.6 g/L sodium bicarbonate, 4.5 g/L glucose, 10 mM HEPES, 1.0 mM sodium pyruvate, 10% (v/v) heat-inactivated fetal bovine serum, and an antibiotic/antimycotic mixture (Gibco BRL, Rockville, MD, USA). The 293T-cell line was obtained from the American Tissue Culture Collection (ATCC, Rockville, MD) and grown in 10% FBS in DMEM.

Drug treatment
Each cell line was incubated with varying concentration of U0126 (Upstate, Charlottesville, VA), rapamycin (Calbiochem, San Diego, CA), and FTI-277 (Calbiochem) dissolved in dimethyl sulfoxide (DMSO). The initial titer of each cell line was 1 × 105 cells per ml. The cells were harvested at various time points for viability assays, proliferation assay, apoptosis analysis, and lysate preparation. Separate control cells were sustained under identical conditions as the treated cells and were exposed to equal volumes of DMSO diluent.

Vector construction
The NPM/ALK gene was obtained from Dr. Stephan Morris (Department of Experimental Oncology, St. Jude’s Children’s Research Hospital, Memphis, TN). After amplification by polymerase chain reaction (PCR), the 2,043 bp gene was inserted into the pcDNA3.1/V5/HIS/TOPO-TA vector (Invitrogen Life Technologies, Carlsbad, CA, USA) and into the pENTR/D-TOPO vector and the insertion and orientation was then confirmed by sequencing. A control pcDNA3.1/V5/HIS vector containing the β-galactosidase (lacZ) gene was provided as part of the TOPO cloning kit. A mutant K210R PCR fragment was obtained by amplification with a forward primer that spans a unique BspE1 site (ALK-K210R_F1, GTGTCCGGAATGCCCAACGACCCAAGCCCCCTGCAAGTGGCTGTGAGGACGCTGCCTG) and contains the A629G mutation and a reverse primer that spans a unique Sac1 site (ALK-K210R_R1, CGCCATGAGCTCCAGCAGGATGAACC). The fragment was amplified using Pfu Turbo DNA polymerase with 2.5 mM MgCl2. After amplification, the fragment was digested with BspE1 and Sac1 and cloned into a similarly digested NPM/ALK construct to replace the wild type sequence with a mutant version. The wild type and mutant NPM/ALK constructs were transformed into One Shot™ TOP10 cells, single colonies isolated, DNA was purified and sequence verified. These entry clones were used to create expression clones by the LR Clonase recombination reaction between the entry vector and the pcDNA-DEST40 Gateway™ vector (Invitrogen, Corp.). Endotoxin free plasmids for transfections were obtained by purification using EndoFree Plasmid Maxi kits (Qiagen Inc. Valencia, CA, USA).

Transfection
Jurkat cells were grown to mid-log phase, and then 107 cells were pelleted and washed twice in 50 ml serum-free Opti-MEM medium (Gibco BRL, Gaithersburg, MD). The cells were then resuspended in 200 µl Opti-MEM, and 30 µg plasmid DNA was gently mixed with the concentrated cells. The cell/plasmid DNA mixture was then transferred to a sterile 4 mm gap electroporation cuvette (Molecular BioProducts, San Diego, CA, USA) and incubated at 25°C for 10 minutes. The cuvette was placed into the electroporation chamber of a BTX T830 electroporation apparatus (Harvard Apparatus, Holliston, MA, USA) and a single 240 mV (LV) pulse of 25 milliseconds was delivered. With care taken to avoid any shock to the cells, the cuvette was transferred to a 37°C incubator for a 30 min recovery, and then the cells were transferred to a flask containing antibiotic-free RPMI 1640. After a 24 hour recovery period, the medium was replaced by RPMI 1640 containing 100 µg/ml G418 (Gibco BRL). After G418 selection for 2–3 weeks, we were able to enhance the expression of the fusion gene by culturing transfected cells in medium containing 30% fetal bovine serum (FBS) (1). Cells were grown in selective medium for two weeks, and then transfectants stably expressing NPM/ALK were screened by RT-PCR and immunoblotting.

Adherent cultures were subcultured at 80% confluency with trypsin-EDTA (Gibco). The cell line 293T was grown in DMEM (Invitrogen, Carlsbad, CA) and 5% FBS (Hyclone, Logan, UT), plated at a density of 90%, and transfected with vector, wild type NPM-ALK and mutant (K210R) NPM/ALK expression constructs in the presence of lipofectamine2000 according to manufacturers recommendations (Invitrogen, Carlsbad, CA).

RT-PCR
Cells were harvested 24 hours after growth in medium plus 30% FBS, and TRIzol reagent (Gibco BRL) was used to extract total RNA from each sample of approximately 106 cells. A Superscript II RT-PCR kit (Gibco BRL) was used to generate cDNA from the total RNA isolated from each of the cell lines. The final cDNA yield for each sample was then determined with a spectrophotometer. Polymerase chain reaction (PCR) was carried out in a Gene Amp 9700 apparatus (Applied Biosystems, Foster City, CA, USA) for 40 cycles (94°C for 40 s, 55°C for 40 s, and 72°C for 60 s, per cycle) in a reaction mixture consisting of 5 µl 10× PCR buffer (100 mM Tris-HCl, pH 8.8, 500 mM KCl, 15 mM MgCl2, 30 mM DTT, 1 mg/ml BSA), 1 µl 10 mM dNTPs, 1 µl each primer (10 µM), 0.5 µl Taq DNA polymerase (5 U/µl, Roche BMB, Indianapolis, IN), 500 ng cDNA template, and deionized-distilled H2O (ddH2O) to a total volume of 50 µl. All PCR products were analyzed by electrophoresis on 1.5% agarose gels. The presence of NPM-ALK transcripts was detected with a primer pair spanning the NPM/ALK translocation breakpoint (2). Additional primer sets were used to measure the levels of the control GAPDH transcript, and also to ensure that the transfecting plasmids were not being carried over into the mRNA assays.

Western blot analysis
Cells were harvested and protein samples (40 µg per well) were separated on a 12% SDS-PAGE and transferred to a HybondECL™ nitrocellulose membrane (Amersham Pharmacia Biotech, Piscataway, NJ, USA). Membranes were blocked with 5% nonfat milk in TBST (100 mM NaCl, 5 mM KCl, 100 mM Tris-HCl, pH 7.4, and 0.05% Tween 20) for 1 hour. Membranes were probed with primary antibody (polyclonal anti-ALK #3342, Cell Signaling Technology, Beverly, MA, USA), at 1:2,000 dilution in TBST containing 5% nonfat milk for 12 hours at 4°C, and then washed four times in TBST, 5 min each. Secondary antibody, conjugated to horse-radish peroxidase (HRP), was diluted 1:4,000 in TBST containing 5% nonfat milk, added to membranes for 2 hours at room temperature, and then washed four times in TBST, 5 minutes each. Luminol reagent (Santa Cruz Biotechnology, Santa Cruz, CA) was added to the membranes, and bands were detected by exposure to film. Membranes were also probed with a monoclonal antibody against B-actin and histone H1 (Santa Cruz Biotechnology) to demonstrate equal loading. Western blot targets were visualized using chemicaluminescence (ECL Plus kit, Amersham). The antibodies are listed in Table S2.

MTT cell proliferation assay
Cells were diluted to 1 × 105/ml, and 100 µl aliquots added in triplicate to wells of a 96-well plate. Then, 10 µl MTT reagent (3-(4, 5-dimethylthiazolyl-2)-2, 5-diphenyltetrazolium bromide, ATCC, Manassas, VA, USA) was added per well with gentle mixing. The plate was incubated at 37°C for 4 hours and then the formazan reaction product was solubilized by addition of 100 µl 10% SDS solution to each well. Plates were read at 570 nm on a Thermo-Max microplate reader (Molecular Devices, Sunnyvale, CA, USA).

Cell cycle analysis
Cells were analyzed at different time points by pelleting 2 × 106 cells, and resuspending in 1.2 ml propidium iodide (PI) solution (50 µg/ml PI in 0.1% sodium citrate plus 0.1% Triton X-100). After 4 hours incubation in the dark at 25°C, cells were analyzed by FACScan flow cytometry (Becton Dickinson, Franklin Lakes, NJ, USA) using Cell Quest software, and G1, G2 + S phase values were recorded.

Caspase 3-activity assay
Caspase-3 activity (CaspACE Assay System, Promega, Madison, WI) measurements were conducted on cells grown under the previously stated conditions. U0126 (Calbiochem, La Jolla, CA) was added to SUDHL-1 cells to create a positive (induced apoptosis) control. Z-VAD-FMK inhibitor was used at a final concentration of 50µM. A negative control was prepared using untreated cells. Following a 23 hour incubation period, the cells were harvested and washed with ice cold PBS and resuspended in cell lysis buffer at a concentration of 108 cells/ml. The cells were lysed by freezing and thawing and then incubated on ice for 15 minutes. The cell lysates were centrifuged at 15,000 × g for 20 minutes at 4°C and the supernatant fraction was collected for use as cell extract. Replicate wells were prepared according to the CaspACE assay system protocol and then incubated for 4 hours at 37°C. The absorbance was measured at 405nm using an ELISA reader.

We have provided the details of our mass spectrometry-drive proteomic analyses listed according to the stipulations of the “Proposed Guidelines for the Analysis and Documentation of Peptide and Protein Identifications” (3).

1. The “peak list” was created from the raw data files using Bioworks 3.1 SR1 (Thermo), and the following parameters: peptide MW range (500–3500) and ion intensity threshold of 10000. A group count of 5, minimum group count of 1, and minimum ion count of 15 was used for .dta generation.

The MS/MS spectra were searched using the SEQUEST algorithm in Bioworks 3.1 SR1 using a precursor mass tolerance of 1.8, a peptide tolerance of 2.5, fragment ion tolerance of 0.5, with 500 results scored. Static modification of cysteine was set as 227.13 and differential modification of cysteine set as 9.0, with 2 missed internal cleavages allowed for the tryptic fragments.

The MS/MS spectra were searched against the human protein entries of the National
Center for Biotechnology Information (NCBI) non-redundant protein database (5/26/05 download of nr.fasta containing 186913 human protein entries).

Database search results were evaluated by using the peptide matching criteria of a cross correlation score (Xcorr) >1.8 for +1 peptides, >2.5 for +2 peptides, and >3.5 for +3 peptides, and a delta correlation score (ΔCn) > 0.100. The SEQUEST .dta and .out files were also analyzed using INTERACT and ProteinProphet. We selected only proteins passing a threshold of less than 5% predicted error for inclusion in our final list.

To assess the quality of the entire dataset, we used was the composite target/decoy database method. Briefly, acquired MS/MS spectra were searched against a protein database containing both forward and reversed amino acid sequences for each protein entry. The total number of proteins identified with reverse sequence entries were then multiplied (2×) to compensate for doubling the size of the database. For the entire dataset, the overall the predicted false positive rate for protein identification by LC-MS/MS was 7.1%. The tandem mass spectra for each of the identified proteins were verified by manual inspection to further diminish the likelihood of false identifications.

2. Detailed information pertaining to each protein sequence identified is provided in Table S1.

3. MS/MS analysis was performed on the LCQ Deca XP ion trap mass spectrometer, using the Surveyor autosampler and MS pumps with Xcalibur software v1.4 installed.

4. ICAT labeling and 3-dimensional liquid chromatography were performed as described previously (4, 5). Briefly, equal amount of proteins (1 mg) in 800 µL lysis buffer were taken for each sample (Jurkat cells transfected with LacZ vs Jurkat cells transfected with NPM/ALK). Proteins were reduced with 2.5 mM Tri(2-carboxyethyl) phosphine (Sigma-Aldrich, St. Louis, MO) for 30 minutes at 37°C. cICAT labeling was carried out by mixing 10 units of light (LacZ Jurkat) or heavy (NPM/ALK transfected Jurkat) cICAT (Applied Biosystems, Foster City, CA) with protein samples following manufacturer’s instruction and incubated for 90 minutes at 37°C. The cICAT reagent contains a thiol-reactive group and biotin moiety which is separated by a linker molecule which is isotopically labeled with either 9 residues of 13C isotope or 12C isotope. Labeled proteins were mixed and dialyzed against 250 mL of urea buffer (2 M urea, 10 mM Tris, pH 8.5) 3 times for 1 hour each at room temperature using the 3.5 kDa cut-off dialysis cassette (Pierce, IL). The dialyzed protein mixtures were then diluted 2-fold with 10 mM Tris, pH 8.5 before digestion with 20 µg modified trypsin (Promega, Madison, WI) overnight at 37°C. The peptide mixtures were then acidified to ≤ pH 3.0 by adding trifluoroacetic acid before loading into the cation-exchange column. The 3-dimensional liquid chromatographic separation of peptides was carried out following these three steps:

a. Strong cation-exchange (SCX) chromatography using a 3.6 mm × 20 cm polysulfoethyl A column (Poly LC Inc., Columbia, MD) at a flow rate of 400 µL/min with 45 fractions collected (600 µL /fraction). A two-step linear buffer gradient was used: 5% buffer B and 95% buffer A to 25% buffer B and 75% buffer A for 50 min followed by 25% buffer B and 75% buffer A to 100% buffer B for 18 min (buffer A, 20 mM KH2PO4, 25% acetonitrile, pH 3.0; buffer B, 350 mM KCl in buffer A, pH 3.0).

b. Each fraction from the SCX chromatography was further purified by an ultralink monomeric avidin affinity cartridge (Applied Biosystems, Foster City, CA) to enrich for the cysteine containing (ICAT-labeled peptides). The eluted peptides were then dried and cleaved as per the manufacturer’s instructions.

c. Reversed-phase capillary chromatography using an in-house packed C18 column (100 µm × 10 cm, Michrom BioResources Inc., Auburn, CA) using an acetonitrile gradient (4). The peptide samples were loaded and analyzed by a LCQ Deca XP ion trap mass spectrometer (Thermo) using an automated method as previously described (6).

Protein quantification was performed using the XPRESS software in Bioworks 3.1 SR1 (Thermo) which calculates the relative abundance of ICAT-labeled peptides as a ratio of light versus heavy (7). A mass tolerance of 1.8 was used, with modification of cysteine set as a difference of 9.0, and scan window of 60.

5. No post-translational modification analysis performed.

6. No 2-D gel or peptide mass fingerprinting performed.

7. Count of unique peptides and assignment of peptides to protein and protein groups was performed during analysis of the total data set using both Bioworks 3.1 SR1 multiple result summary view and INTERACT/ProteinProphet analysis.

8. Raw MS data files were archived and are available upon request.

Analysis of NPM/ALK-deregulated pathways by knowledge-based structured network analysis tool (Ingenuity Pathway Analysis)
Differentially expressed proteins were further analyzed using Ingenuity Pathways Analysis. Protein accession numbers and corresponding cICAT expression values were saved into the Ingenuity Systems template.xls file. Files were submitted on-line for analysis and comparison to the Ingenuity gene/protein interaction knowledge base. The results for the pathway analysis were summarized and interaction network images generated with respect to cellular location and putative canonical pathways.

Immunofluorescence and confocal microscopy
Cells plated onto coverglass chamberslides were fixed with 3.7% formaldehyde for 10 minutes, permeabilized and blocked with a PBST solution (1× PBS, 0.1% Triton, 1% BSA, 0.01% NaN3) for 30 minutes, and washed sequentially with 1× PBS. Cells were incubated with primary antibodies (1:100 or 1:200) for 1 hour. Primary antibodies include: ALK-1 (Cell Signaling), Phospho-ALK (Cell Signaling), Phospho-Tyr (Upstate 4G10), RhoA (Santa Cruz Biotechnology) and Paxillin (Santa Cruz Biotechnology). After additional PBS washes, cells were incubated with 7.5 µg/ml FITC goat anti-rabbit IgG (Molecular Probes, Eugene, OR) and a 1:25 dilution of Texas Red-X Phalloidin (Molecular Probes). Cells were sequentially washed in 1× PBS and mounted with gelvatol and SlowFade Light antifade reagent (Molecular Probes). Confocal images were acquired using an Olympus FluoView (FVX200) laser scanning microscope (Olympus, Melville, NY) with a 60× oil inversion objective on a Olympus confocal microscope using argon and helium/neon laser excitation lines of 488 and 568 nm respectively and 510, 550 and 605 nm band-pass emission filters.

Adhesion and invasion assay
Adhesion properties of cells expressing NPM/ALK (SUDHL-1 and NPM/ALK transfected 293T) were compared to cells lacking the fusion protein (Jurkat, vector transfected 293T). Cells were plated onto human plasma fibronectin (Chemicon International, Temecula, CA) and allowed to adhere 24 hours. Media was removed and adherent cells were stained with crystal violet and manually counted.

For invasion assays, cells were plated at a density of 1 × 105 cells in 0.25 ml volume on BD Biosciences BioCoat membranes with Matrigel. Matrigel coated PET membranes were incubated with 1× PBS for 2 hours in a 37°C 5% humidified CO2 incubator prior to addition of transfected cells. Vector and NPM-ALK transfected NIH3T3 cells were scraped off the dish after 22–24 hours and plated onto BD BioCoat membranes (1.25 × 105 cells/0.25 ml) and incubated an additional 24 hours. Non-invading cells were swabbed from the top surface of the membranes. Cells remaining were washed one time in 1× PBS then fixed 4 minutes in methanol. Cells were immersed in a Crystal Violet stain (20% ethanol, 0.05 % crystal violet) 30 minutes to 16 hours. Membranes were cut from inserts and imbedded in gelvatol and sandwiched between microscope slides; cells were scored by light microscopy under 20× magnification.

Tissue microarray construction and immunohistochemistry
Tumor specimens from ALK-positive anaplastic large cell lymphomas, ALK-negative ALCL, cutaneous anaplastic large cell lymphomas, Hodgkin lymphomas and reactive lymphoid tissues including chronic tonsillitis and lymphadenitis were obtained from the surgical pathology files of the Department of Pathology, University of Utah School of Medicine, Salt Lake City, Utah from the period of 1995 to 1998 and the Department of Hematopathology, The University of Texas MD Anderson Cancer Center, Houston, TX. This study was approved by the Institutional Review Boards of the University of Utah and MD Anderson Cancer Center. Tissues were formalin-fixed and paraffin-embedded for histopathological diagnosis and immunohistochemical study. Malignant lymphoma cases were classified according to the World Health Organization classification of lymphoid neoplasms (8) and reviewed by four hematopathologists (MSL and KEJ at the University of Utah and GR and LJM at MD Anderson Cancer Center). Hematoxylin and eosin stained slides from tissue biopsies were marked for areas with dominant areas of lymphoma cells that were used to obtain cores for the generation of tissue microarrays. Tissue microarrays were manually constructed using an array (Beecher Instruments Microarray Technology, Sun Prairie, WI) using a 2-mm needle. Five µm-thick serial sections were mounted on glass slides coated with 2% aminopropyltrioxysilane (APES; Sigma Chemicals, St. Louis, MO) in acetone. Sections were dewaxed in xylene and rehydrated in graded ethanols. Endogenous peroxidase activity was blocked by immersion in 0.3% methanolic peroxide for 15 min. Antigen-antibody reactions were visualized with the chromogen diaminobenzadine. Normal mouse serum containing mixed immunoglobulins at a concentration approximating that of the primary antibody was used as a negative control. Sections were counterstained with hematoxylin. A normal tonsil was used as a positive control for all antibodies.

Files in this Data Supplement:

  • Table S1. Functional categorization of differentially expressed proteins (PDF, 130 KB) -
    Proteins that are differentially expressed by greater than 1.5-fold in NPM/ALK transfected cells are analyzed by GoMiner bioinformatics tool. Proteins were categorized into the following functional groups: adaptors and chaperones, cell cycle, signaling, cell adhesion, and structure, transcription and unknown. The corresponding NCBI gene identification numbers (GI#), peptide sequences, MH+, z, Xcorr, dCn, ICAT ratios and predicted error rates are indicated for each protein.

  • Table S2. Antibodies used for western blot analyses (PDF, 27.8 KB) -
    Source, dilution and type of antibodies used for western blot analyses are listed.

  • Table S3. Antibodies used for immunohistochemistry (PDF, 13.5 KB) -
    Source, dilution and type of antibodies used for immunohistochemical analyses are listed.

  • Figure S1. Expression of NPM/ALK gene, protein and phosphorylated protein in NPM/ALK transfected Jurkat cells (JPG, 181 KB) -
    (A) RT-PCR analysis of Jurkat, vector transfected Jurkat (Jc) and NPM/ALK transfected Jurkat cells (JT) demonstrated high levels of expression of NPM/ALK in JT but not J or Jc which was comparable to that seen in cell lines derived from NPM/ALK-positive ALCL Karpas 299 (K) and SUDHL-1 (S). (B) Western blot analysis demonstrated expression of NPM/ALK protein recognized by anti-ALK antibody in NPM/ALK transfected Jurkat (JT) but not in Jurkat (J) or vector transfected Jurkat (Jc). The level of NPM/ALK protein was comparable to that seen in the Karpas299 (K) and SUDHL-1 (S) cells. Equal loading of protein was assessed by evaluation of histone H1 which demonstrated similar levels of expression in all cell lines. (C) Western blot analysis demonstrated the expression of phosphorylated ALK in the NPM/ALK transfected Jurkat (JT) but not in the vector transfected Jurkat (Jc) cells or the NPM/ALK-negative T-cell line Mac 2A. The expression of phosphorylated ALK was seen in the Karpas299 and SUDHL-1 cells.





  • Figure S2. Complex global proteomic network changes induced by NPM/ALK expression (JPG, 531 KB) -
    (A) Functional categorization of proteins (greater than 1.5-fold) according to Gene Ontology annotation indicates that proteins from diverse cellular compartments and (B) involved in diverse molecular functions are differentially expressed as a consequence of constitutive NPM/ALK expression. (C) Differentially expressed proteins (Table 1) were analyzed using a knowledge-based structured-network tool (Ingenuity Pathway analysis). The composite interaction networks from multiple signaling pathways are highlighted and show that constitutive NPM/ALK expression affects multiple signaling modules involved in diverse biological roles such as those involved in cell cycle regulation, MAPK, IL-6, IGF-1, integrin, NF-kB, PPAR and G-protein, JAK/STAT, PDGF, TGF-b, PI3K/AKT and insulin receptor.





    REFERENCES

    1. Y. J. Chan, C. J. Chiou, Q. Huang, G. S. Hayward, J Virol 70, 8590 (Dec, 1996).
    2. J. A. Schumacher, S. D. Jenson, K. S. Elenitoba-Johnson, M. S. Lim, J Mol Diagn 6, 16 (Feb, 2004).
    3. R. A. Bradshaw, Mol Cell Proteomics 4, 1223 (Sep, 2005).
    4. S. P. Gygi, B. Rist, T. J. Griffin, J. Eng, R. Aebersold, J Proteome Res 1, 47 (Jan–Feb, 2002).
    5. D. K. Han, J. Eng, H. Zhou, R. Aebersold, Nat Biotechnol 19, 946 (Oct, 2001).
    6. Z. Lin, D. K. Crockett, M. S. Lim, K. S. Elenitoba-Johnson, J Biomolecular Techniques 14, 149 (June, 2003).
    7. S. P. Gygi et al., Nat Biotechnol 17, 994 (Oct, 1999).
    8. Jaffe ES, Harris NL, Stein H, Vardiman JW, Pathology and Genetics of Tumours of Hematopoietic and Lymphoid Tissues, World Health Organization Classfication of Tumours (IARC Press, International Agency for Research on Cancer., Lyon, 2001).




This Article
Right arrow Abstract
Right arrow Full Text
Services
Right arrow Email this article to a friend
Right arrow Alert me to new issues of the journal
Right arrow reprints & permissions
Right arrow Rights and Permissions
Citing Articles
Right arrow Citing Articles via CrossRef

 click for free articles
home about blood authors subscriptions permissions advertising public access contact us
  Copyright © 2009 by American Society of Hematology         Online ISSN: 1528-0020