Blood, 15 May 2003, Vol. 101, No. 10, pp. 4222-4222
CORRESPONDENCE
To the editor:
Reassessment of loss of heterozygosity within MLL
in childhood acute lymphoblastic leukemia
Loss of heterozygosity (LOH) studies are useful to detect tumor
suppressor genes involved in human cancers. In childhood acute lymphoblastic leukemia (ALL), LOH has been reported for many
chromosomal regions, including 11q23, close to the MLL
gene. Previously in this journal, Webb and
colleagues1 reported LOH of a polymorphic trinucleotide
repeat (mllGAAn) in intron 6 of the MLL gene. The heterozygosity index of the repeat was reported to be 0.54, and LOH was
found in 6 (40%) of 15 of the informative ALL cases. The MLL gene is flanked by 2 polymorphic microsatellite
markers (D11S1356 and D11S1364) that have been used to determine LOH.
Surprisingly, Webb and colleagues found no LOH at these 2 markers.
Other studies have reported LOH of D11S1356 in 4%-16% of ALL
cases.2-4 Löchner and colleagues5
showed LOH in exon 8 of MLL in 3 (4%) of 74 T-lineage ALL cases.
We attempted to assess the prevalence of LOH within the MLL
gene, using 40 cases of ALL.
Children with ALL were recruited at pediatric oncology clinics
throughout New Zealand. DNA was extracted from unfixed diagnostic and
remission bone marrow slides as published.6 Parental DNA was extracted from peripheral blood leukocytes. LOH at mllGAAn was
assessed using polymerase chain reaction (PCR) amplification (forward primer: TCCCCGCCCAAGTATCCCTGTAAAA, reverse primer:
GCTGCGCCTTGCCAAGCCTAAAT, 30 cycles, annealing temperature 58°C). The
-P32dCTP-labeled PCR products were electrophoresed on
6% denaturing polyacrylamide sequencing gel.
Initially, the mllGAAn polymorphism was reassessed among unrelated
individuals. Surprisingly, only 2 of 36 unrelated individuals were
heterozygous. Then, 40 ALL cases were tested for LOH and microsatellite
instability (MSI) at the mllGAAn locus. Only 1 case was
informative for the study of LOH, and in this case the leukemic DNA
showed retention of heterozygosity. In 18 cases the leukemic DNA was of
sufficient quality to assess MSI. MSI was not detected in any of
these cases.
Our results contrast with those reported by Webb and
colleagues.1 They found a high heterozygosity index
(0.54), an LOH rate of 40% (6 of 15 informative cases), and an MSI
rate of 10% (3 of 29 cases). In other reports, MSI on 11q was reported
in 10 (8.8%) of 114 cases at D11S13563 and in none of 40 cases at 8 different markers.7
We noted that PCR primers were difficult to design, because the mllGAAn
polymorphism was located within an Alu repeat element. Our primers were
designed to avoid this repeat, but we note that the primers of Webb and
colleagues are situated within the repeat element. Furthermore, their
forward primer binds in numerous sites throughout the genome. As a
consequence we doubt that the results of Webb and colleagues reflect
LOH or MSI of the MLL gene.
Examination of 13 independent sequences from National Center for
Biotechnology Information (NCBI) GenBank confirms that length variation does occur at the mllGAAn locus. Additional research with a
larger number of ALL cases will be required to determine the true
frequency of intragenic LOH of the MLL gene.
Carina J. M. van Schooten, Lana M. Ellis, and Ian M. Morison
Correspondence: Ian M. Morison, Cancer Genetics
Laboratory, Department of Biochemistry, University of Otago, PO Box 56, Dunedin, New Zealand; e-mail:
ian.morison{at}otago.ac.nz
Acknowledgments
Supported by a grant from the Cancer Society of New Zealand.
References
1.
Webb JC, Golovleva I, Simpkins AH, et al.
Loss of heterozygosity and microsatellite instability at the MLL locus are common in childhood acute leukemia, but not in infant acute leukemia.
Blood.
1999;94:283-290[Abstract/Free Full Text].
2.
Haidar MA, Kantarjian H, Manshouri T, et al.
ATM gene deletion in patients with adult acute lymphoblastic leukemia.
Cancer.
2000;88:1057-1062[CrossRef][Medline]
[Order article via Infotrieve].
3.
Pabst T, Schwaller J, Bellomo MJ, et al.
Frequent clonal loss of heterozygosity but scarcity of microsatellite instability at chromosomal breakpoint cluster regions in adult leukemias.
Blood.
1996;88:1026-1034[Abstract/Free Full Text].
4.
Takeuchi S, Cho SK, Seriu T, et al.
Identification of three distinct regions of deletion on the long arm of chromosome 11 in childhood acute lymphoblastic leukemia.
Oncogene.
1999;18:7387-7388[CrossRef][Medline]
[Order article via Infotrieve].
5.
Löchner K, Siegler G, Führer M, et al.
A specific deletion in the breakpoint cluster region of the ALL-1 gene is associated with acute lymphoblastic T-cell leukemias.
Cancer Res.
1996;56:2171-2177[Abstract/Free Full Text].
6.
Morison IM, Ellis LM, Teague LR, Reeve AE.
Preferential loss of maternal 9p alleles in childhood acute lymphoblastic leukemia.
Blood.
2002;99:375-377[Abstract/Free Full Text].
7.
Takeuchi S, Seriu T, Tasaka T, et al.
Microsatellite instability and other molecular abnormalities in childhood acute lymphoblastic leukaemia.
Br J Haematol.
1997;98:134-139[CrossRef][Medline]
[Order article via Infotrieve].
Response:
Loss of heterozygosity at the MLL locus
The letter from van Schooten et al is provocative as it seems to
contradict data that we have previously published in this journal.1 The issue centers around the level of
heterozygosity at the mllGAAn microsatellite, and the authors suggest
that poor experimental design on our behalf means that our results are
doubtful. We are confident that our findings are accurate and wish to
respond to these comments.
The criticism is that one of the primers is located within Alu
sequences. We were aware of this at the time and tried a number of
different pairs of primers but found the one used the most efficient.
The polymerase chain reaction (PCR) was optimized carefully to
avoid mispriming, and only the non-Alu primer was end-labeled. To
confirm that the alleles observed were genuine, we analyzed the
polymorphism in 2 families and found no discrepancies. The result from
one of these families is shown in lanes 1, 2, and 3 of Figure 2 from
the original paper.1(p286) To further confirm that
these amplification products were polymorphic alleles, we directly
sequenced from the PCR products of the 2 most common alleles (J.C.W.,
unpublished work, August 1998). We did not sequence the rarer
allele, as there were no homozygous samples. We also confirmed that the
polymorphic alleles were in Hardy-Weinberg equilibrium, and it would be
unlikely that we would see this ratio if we were amplifying random bits
of the genome. Finally, repeat remission samples for some of the
patients existed and, where possible, these also were amplified
(unpublished work). Again, we found no discrepancies. For these
reasons we believe that our data are sound.
van Schooten et al do not suggest any alternative explanations for the
discrepancies between the 2 sets of data. Racial differences in the
normal population groups or sample size may account for some of the
inconsistency. An alternative explanation is that van Schooten et al
have not resolved the PCR products sufficiently. This would result in
the 2 most common alleles appearing to be the same size and only the
larger allele distinguishable as a polymorphism. Consequently, the
heterozygosity frequency would appear much lower than it actually is,
since the larger allele is much rarer. In our hands the frequency of
the rarer allele was 0.07, and this is consistent with the frequency of
0.06 observed in van Schooten et al's control samples. Poor resolution
of the PCR products may also explain why no microsatellite instability was observed in the acute lymphoblastic leukemia samples.
The authors also suggest that the loss of heterozygosity (LOH)
we saw was purely artifactual. It is worth pointing out that we were
able to confirm LOH in 2 of these samples by fluorescence in situ
hybridization analysis. Since then, there have been a number
of papers describing LOH at the MLL gene locus using various different methods.2-4 van Schooten et al's suggestion
that there is no LOH at this polymorphism is not backed up by
their data: they see very little heterozygosity, and it is not possible
to detect loss of a homozygous allele when using only a nonquantitative PCR-based technique.
Julie Webb
Correspondence: Julie C. Webb, MRC CSC, Lymphocyte
Development Group, Imperial College, Hammersmith Hospital, London,
United Kingdom; e-mail:
julie_webb55{at}hotmail.com
References
1.
Webb JC, Golovleva I, Simpkins AH, et al.
Loss of heterozygosity and microsatellite instability at the MLL locus are common in childhood acute leukemia, but not in infant acute leukemia.
Blood.
1999;94:283-290[Abstract/Free Full Text].
2.
Haidar MA, Kantarjian H, Manshouri T, et al.
ATM gene deletion in patients with adult acute lymphoblastic leukemia.
Cancer.
2000;88:1057-1062[CrossRef][Medline]
[Order article via Infotrieve].
3.
Takeuchi S, Cho SK, Seriu T, et al.
Identification of three distinct regions of deletion on the long arm of chromosome 11 in childhood acute lymphoblastic leukemia.
Oncogene.
1999;18:7387-7388[CrossRef][Medline]
[Order article via Infotrieve].
4.
Mathew S, Behm F, Dalton J, Raimondi S.
Comparison of cytogenetics, Southern blotting, and fluorescence in situ hybridization as methods for detecting MLL gene rearrangements in children with acute leukemia and with 11q23 abnormalities.
Leukemia.
1999;13:1713-1720[CrossRef][Medline]
[Order article via Infotrieve].
