SEARCH:   Advanced

Prepublished online as a Blood First Edition Paper on December 27, 2002; DOI 10.1182/blood-2002-07-2301. This Article Full Text (PDF) All Versions of this Article: 2002-07-2301v1 101/9/3615    most recent Alert me when this article is cited Alert me if a correction is posted Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Rights and Permissions Citing Articles Citing Articles via HighWire Citing Articles via CrossRef Citing Articles via Google Scholar Google Scholar Articles by Hiraiwa, N. Articles by Kannagi, R. Search for Related Content PubMed PubMed Citation Articles by Hiraiwa, N. Articles by Kannagi, R. Social Bookmarking                   What's this? Submitted July 31, 2002 Accepted December 2, 2002 Transactivation of the fucosyltransferase VII gene by human T-cell leukemia virus type 1 tax through a variant cAMP-responsive element Nozomu Hiraiwa, Tomonori Yabuta, Keijiro Yoritomi, Miki Hiraiwa, Yuetsu Tanaka, Takeshi Suzuki, Mitsuaki Yoshida, and Reiji Kannagi* Department of Molecular Pathology, Aichi Cancer Center, Nagoya, Aichi, Japan Department of Infectious Disease and Immunology, Research Center of Medical Science, University of the Ryukyus, Nishihara, Okinawa, Japan Department of Cellular and Molecular Biology, The Institute of Medical Science, University of Tokyo, Tokyo, Japan * Corresponding author; email: rkannagi{at}aichi-cc.jp. Human T-cell leukemic virus type 1 (HTLV-1)-infected T cells express fucosyltransferase (Fuc-T) VII gene involved in the biosynthesis of the leukocyte sialyl Lewis X, which may be related to tissue infiltration in cases of malignant adult T-cell leukemia. HTLV-1 induces the Fuc-T VII gene transcription through the viral transactivator Tax, although the underlying molecular mechanism remains unknown. In the present study, we analyzed the role of the cis-activating element in Tax activation using reporter constructs bearing the 5'-regulatory region of the Fuc-T VII gene in Jurkat T cells, a sequence (GGCTGTGGGGGCGTCATATTGCCCTGG) covering a half-palindromic cAMP-responsive element (CRE) was found to be required for Tax activation of the Fuc-T VII promoter. We further demonstrated that transcription factors of the CRE-binding protein(CREB)/activating transcription factor(ATF) family bind to this CRE-like sequence and that Tax binds in association with CREB and the coactivator CREB-binding protein (CBP) in Jurkat T cells. This element containing the (G+C)-rich flanking sequences is much homologous to the Tax-responsive viral CREs in the HTLV-1 long terminal repeat (LTR)-promoter. Furthermore, CREM, an isoform of CREB deficient in the glutamine-rich domains, was found to activate the Fuc-T VII promoter in a phosphorylation-independent manner, similar to the viral CRE in HTLV-1 LTR, but in contrast to the phosphorylation-dependent activation of the cellular CREs by Tax. These findings indicate that the Fuc-T VII promoter is transactivated by Tax in concert with CBP through a CRE-like sequence in a similar fashion to the viral CRE in HTLV-1 LTR. CiteULike    Connotea    Del.icio.us    Digg    Reddit    Technorati    What's this? This article has been cited by other articles: K. Nystrom, R. Norden, I. Muylaert, P. Elias, G. Larson, and S. Olofsson Induction of sialyl-Lex expression by herpes simplex virus type 1 is dependent on viral immediate early RNA-activated transcription of host fucosyltransferase genes Glycobiology, August 1, 2009; 19(8): 847 - 859. [Abstract] [Full Text] [PDF] R. Norden, K. Nystrom, and S. Olofsson Activation of host antiviral RNA-sensing factors necessary for herpes simplex virus type 1-activated transcription of host cell fucosyltransferase genes FUT3, FUT5, and FUT6 and subsequent expression of sLex in virus-infected cells Glycobiology, July 1, 2009; 19(7): 776 - 788. [Abstract] [Full Text] [PDF] G.-Y. Chen, K. Sakuma, and R. Kannagi Significance of NF-{kappa}B/GATA Axis in Tumor Necrosis Factor-{alpha}-induced Expression of 6-Sulfated Cell Recognition Glycans in Human T-lymphocytes J. Biol. Chem., December 12, 2008; 283(50): 34563 - 34570. [Abstract] [Full Text] [PDF] K. Nystrom, A. Grahn, M. Lindh, M. Brytting, U. Mandel, G. Larson, and S. Olofsson Virus-induced transcriptional activation of host FUT genes associated with neo-expression of Ley in cytomegalovirus-infected and sialyl-Lex in varicella-zoster virus-infected diploid human cells Glycobiology, April 1, 2007; 17(4): 355 - 366. [Abstract] [Full Text] [PDF] G.-Y. Chen, H. Osada, L. F. Santamaria-Babi, and R. Kannagi Interaction of GATA-3/T-bet transcription factors regulates expression of sialyl Lewis X homing receptors on Th1/Th2 lymphocytes PNAS, November 7, 2006; 103(45): 16894 - 16899. [Abstract] [Full Text] [PDF] M.-X. Guo, D. Wang, H.-J. Shao, H.-L. Qiu, L. Xue, Z.-Z. Zhao, C.-G. Zhu, Y.-B. Shi, and W.-X. Li Transcription of Human Zinc Finger ZNF268 Gene Requires an Intragenic Promoter Element J. Biol. Chem., August 25, 2006; 281(34): 24623 - 24636. [Abstract] [Full Text] [PDF] K. Ohmori, F. Fukui, M. Kiso, T. Imai, O. Yoshie, H. Hasegawa, K. Matsushima, and R. Kannagi Identification of cutaneous lymphocyte-associated antigen as sialyl 6-sulfo Lewis X, a selectin ligand expressed on a subset of skin-homing helper memory T cells Blood, April 15, 2006; 107(8): 3197 - 3204. [Abstract] [Full Text] [PDF] J. Kikuchi, H. Shinohara, C. Nonomura, H. Ando, S. Takaku, H. Nojiri, and M. Nakamura Not core 2 {beta}1,6-N-acetylglucosaminyltransferase-2 or -3 but -1 regulates sialyl-Lewis x expression in human precursor B cells Glycobiology, March 1, 2005; 15(3): 271 - 280. [Abstract] [Full Text] [PDF] S. K. Patnaik, B. Potvin, and P. Stanley LEC12 and LEC29 Gain-of-Function Chinese Hamster Ovary Mutants Reveal Mechanisms for Regulating VIM-2 Antigen Synthesis and E-selectin Binding J. Biol. Chem., November 26, 2004; 279(48): 49716 - 49726. [Abstract] [Full Text] [PDF] N. Markine-Goriaynoff, L. Gillet, J. L. Van Etten, H. Korres, N. Verma, and A. Vanderplasschen Glycosyltransferases encoded by viruses J. Gen. Virol., October 1, 2004; 85(10): 2741 - 2754. [Abstract] [Full Text] [PDF] M. D. Dodon, Z. Li, S. Hamaia, and L. Gazzolo Tax protein of human T-cell leukaemia virus type 1 induces interleukin 17 gene expression in T cells J. Gen. Virol., July 1, 2004; 85(7): 1921 - 1932. [Abstract] [Full Text] [PDF] T. Koike, N. Kimura, K. Miyazaki, T. Yabuta, K. Kumamoto, S. Takenoshita, J. Chen, M. Kobayashi, M. Hosokawa, A. Taniguchi, et al. Hypoxia induces adhesion molecules on cancer cells: A missing link between Warburg effect and induction of selectin-ligand carbohydrates PNAS, May 25, 2004; 101(21): 8132 - 8137. [Abstract] [Full Text] [PDF]

	Copyright © 2002 by American Society of Hematology         Online ISSN: 1528-0020